Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for clone EY936840

This EST belongs to unigene UN14641

FASTA Sequence
GenBank Acc#: EY936840 Length: 104
TCAATGCAGTTTGTTTCCATTTACTTTAAAAAATATGCTTCAAATTGTTTATCTATCGATCGATCCCTTCAATCTGGTCTTCGACC
TGAGAGTACAAGTCCTTG

cDNA Library Information
Library nameRS2(RS)
Number of clones40812
CultivarRaphanus sativus cv Early Scarlet Globe
Tissuewhole seedling (with 1 set of true leaves), buds, and anthers
Description5' end sequencing