Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for clone T25167

This EST belongs to unigene UN07449

FASTA Sequence
GenBank Acc#: T25167 Length: 179
TTGATATCCAGAAGTTCTACAATGTTGTNGTTGAGGAGCTTCCATCAAACGTAGNCGATCTTCTTTGAAGAAGGAAGAAGAAAGGA
AAGGTTGCTTGGTTTGCAAGTTTCTTATTTGATTTTTGACCTATCTCTCTCTCTCTTTCTGAATTATATCGAGACCANTTTTTTCT
TTTTTTC

cDNA Library Information
Library nameATR-4H
Number of clones61
CultivarRaphanus sativus cv Scarlet Globe
Tissueroot
Descriptionradish roots that had been cultured in 30 5M IAA for 4 hours to induce the formation of new lateral root primordia. The segments were 1 cm in lenght and located 0.5 cm from the root tip so that they contained mature root cells but had not initiated any lateral primordia at the start of the culture period