Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for clone EV573697

This EST belongs to unigene UN09215

FASTA Sequence
GenBank Acc#: EV573697 Length: 873
ATCATAACCAAAGTTGATTTTTCAAGGTAATAACAGAAGGAATGTAGCATGAAAACAGAAAATAAACTTGCCACTCACACACAAAA
AACAAACCGATGATGTACATTCTCAACACAAACACAAACAGAAATTACATACTCTAACTATATAGATAGATGGTAACATATCTGTA
GAGTGGGAAACATTAGAGACCTCTTTGAATACCAGATGAATATCATCTCTTCCACTCTACCTGAGCTGTCTTCCCATTGCCTTCTC
GGGCCGAAGGTTTCTCGGTCTTCTTCCCGGTTTTGCCACCAGAGTTTGAGACTCTTGTTGTCTTAGGAGAATCAGAAGTGACTCTT
GCGCTATTACCTGAAGATGGCAGTGAGTAACGTCTAGTGGCTTTCTCAGCCCCTTGTTGCTTAGGAGAAGAAGAGCCTTGTTGTAG
CCTCAGCTTTGCTTTTGCGGATTTAGTCGCTTGCATATAGCTTGGTAGCCCCGGGGTACTACTCTGATTCACATCACTACTCTTTT
GACACTCAGCAGCTTGAGTAGTAGTAGTAGTAGTAGTAGTAACCGGAGAATCCTTCTTCCTTGATTTTTTATTCTCCTTCCCAGCT
GAGTTCTTTTGTTTGGGAGTTCTCTCTTCTTTCACATCCTCCTCCTTCTCCTCAGCCATAACATTTTCTTGGCTCTCTATCACCAA
CGGAGAATCAGGTGCTTCATTGGTCTCCAACGGTCCATGAGTGTGAACTATCTCCACCACAGTCTCAGCCGTTTCATCCTTTTCTT
CTTCAGCAAAGACACTCACAGGTTGTTCTAAAGCTAGAGCTGGCTTCTCAATCTCCAGCTTCTCTGGAGATGGTTGGGGTTGGATA
GAGCTCTCAACTA

cDNA Library Information
Library nameRR4(PB)
Number of clones41398
CultivarRaphanus raphanistrum subsp. landra
Tissuewhole seedling (with 1 set of true leaves), buds, and anthers
Description5' end sequencing