Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for clone EW728820

This EST belongs to unigene UN23341

FASTA Sequence
GenBank Acc#: EW728820 Length: 130
TTTGCAGTCATCATGGACTGCCATTTCCCGACGCCGCATTAGCCATGGCTGAATCAAGACGAGATTACTGCTGAAAGGAGACGCAA
AGAGGGTGAATATATTATGTTTTCTTCGAATATGACTCTTTTCC

cDNA Library Information
Library nameRS2(RS)
Number of clones40812
CultivarRaphanus sativus cv Early Scarlet Globe
Tissuewhole seedling (with 1 set of true leaves), buds, and anthers
Description5' end sequencing