Information for clone EW734627
| This EST belongs to unigene UN06238 |
| FASTA Sequence |
| GenBank Acc#:
EW734627 |
Length: 104 |
GGAGCTCCGCTGTTGCCTCTACAACTCTCTCTCTCTCTATCTCCATGGCTCTCGCGTTTCAGTTCTGCCGATTATGCATCCGCCCG
AATACTTTCTCCCCCGGA
|
|
|
| cDNA Library Information |
| Library name | RS3(RT) |
| Number of clones | 41027 |
| Cultivar | Raphanus sativus cv Rat-Tail Radish #3870 |
| Tissue | whole seedling (with 1 set of true leaves), buds, and anthers |
| Description | 5' end sequencing |
|
|
|