Information for clone EY913747
| This EST belongs to unigene UN16121 |
| FASTA Sequence |
| GenBank Acc#:
EY913747 |
Length: 139 |
GAATCGACGTTGCGTTGTACCGCCACAATCGGTCGTAGATGGCTTACAGAGGAGGACGAGGAAGAGGAAGAGGTGGGTTTGGTGGG
TTTGGCGTTGAGTACGCAAAGGCCGAACCTTTCGTTATCTTCCCTGACATTAC
|
|
|
| cDNA Library Information |
| Library name | RR3(NY) |
| Number of clones | 41066 |
| Cultivar | Raphanus raphanistrum subsp. raphanistrum (NY) |
| Tissue | whole seedling (with 1 set of true leaves), buds, and anthers |
| Description | 5' end sequencing |
|
|
|