Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for clone FD564991

This EST belongs to unigene UN07723

FASTA Sequence
GenBank Acc#: FD564991 Length: 849
AGAGAAACTAATAACAAAATAAAGGAAAACAAGTAAGCTGAAAGCTATATTACATACAAAAATTATGAAAAGATTACCATTTTTAG
GAAACAAAAGAATCATAAATAGCGTGTACACCACTCCACCGTTTAAACAGACCCAGCCACGGCCTAACCCTAACCGAACCGGACCC
AGAATCGTTCGTCAGTGGCAAAACCGTCAATATGAAACTAACGCGGAGAAGAAGAAGAAGAAGACAAGAAGAACAGGGAGGAGCAC
GGAGGCGAAGACAGAGACTTCTGGTCGGAAACCACCGCTGGGGAGAAAAGGGTAAGTGTCAGGAGGCGGCATGACACAGTTGTCTC
CATTAAAGTAGATCCTACGAGGAAAAGCCCATCCTTTCTCAAACGAGAAGGTTGCTTGATCCTTACGGAACAGAATCTCTGACTGC
ACATTCCCAAGAGGCCCTGCTTCTGATAAGAAGTCATTATAGAACTTCACTCCCCACAACATCGCCGTATCATTTAGTCCTGCATA
AGGAGTGAGAGATTTGTAGTTGAAACTAAAGATCTGAGTGATGTTGTCGAAATTCGGATGTTGTGCCACCATGTTCCACTGCGAGT
AGTTTAAACGGTAGTTGAAGTTTGTGATCGTGATCTTCACTCGCCAATACTCTTTGTAGTTCTGCTTCACGTGCCAATGCACTCTG
ATGGGACACAAGTGTCTTGTGCATTGCACCAGTGGAGGCAAGATGGTTCCTTTTCTTGGTCGGTGGTGAGACGACAGAAGCCAAGT
GCGGTGTATCAGGGTCGAGACAGGCACCGGACTCTGTTCTGTTGTTTTGGCATCCGCAAGCGCAAGTTGGACATC

cDNA Library Information
Library nameRS1(AR)
Number of clones39802
CultivarRaphanus sativus var. oleiformis
Tissuewhole seedling (with 1 set of true leaves), buds, and anthers
Description5' end sequencing