Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for clone FD574969

This EST belongs to unigene UN10168

FASTA Sequence
GenBank Acc#: FD574969 Length: 102
GAACACATAGTTAAGACTTTATTACATTTTTAAAAGTACAACCAAAGTAAAACTATTGCCGAAGTACATGATCCAGTTGTGTACAG
AGAATCCAGATAAGCA

cDNA Library Information
Library nameRS2(RS)
Number of clones40812
CultivarRaphanus sativus cv Early Scarlet Globe
Tissuewhole seedling (with 1 set of true leaves), buds, and anthers
Description5' end sequencing