Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for clone FY446505

This EST belongs to unigene UN19948

FASTA Sequence
GenBank Acc#: FY446505 Length: 695
TCTGTCTCTTCAAGACCGAAGCTTTTGTTTTCTACTGCCGGAAACGATGCCAGTTGACGAATCTTTAATTACGCCCGGGAAAACAG
TCTGCGTCACTGGTGCTGGTGGATACATCGCTTCTTGGATTATTAAGTTACTCCTTGAGAGAGGCTACACGGTCAAAGGAACCGTA
CGGAATCCAGATGATCCGAAGAACACACATTTGAGAGAACTAGAAGGGGCCAAGGAGAGACTGATTCTGTGCAAAGCAGATCTCCA
GGACTATGATGCTCTTAAGGAGGCTATCGATGGTTGCGATGGCGTCTTTCACACGGCTTCTCCGGTCACTGACGATCCCGAAGAAA
TGGTGGAGCCGGCCGTGAACGGAGCCAAGTTCGTAATTAATGCTGCAGCTGAAACCAAGGTGAAGCGCGTGGTCATCACCTCCTCA
ATTGGTGCGGTCTACATGGACCCGAACCGTGACCCTGAAGCCGTTGTTGACGAAAGTTGTTGGAGTGATCTTGAGTTCTGCAAAAA
CACTAAGAATTGGTATTGTTACGGCAAGATGGTGGCGGAGCAAGCGGCGTGGGAGACGGCAGAGGAGAAAGGTGTTGACCTGGTGG
TTTTGAATCCGGTGCTGGTTCTTGGTCCGCCGTTACAGCCGACGATCAACGCCAGTCTCTTCCACGTACTAAAGTATCTAACCGGC
TCGGCTA

cDNA Library Information
Library nameRaphanus sativus GSK3-1 seedling
Number of clones8454
CultivarRaphanus sativus cv GSK3-1
Tissueseedling
DescriptionNA