Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN00120

FASTA Sequence
Unigene ID: UN00120Length: 1372 SSR 
GGCTCTCTCACTACTTTGCGCTTGTCTTTCTCTCTCTCTCTCTTCGAACTTTGGTTTTTGCTCTGTTTATTCACCAATGGCTACTG
TGTGGAGAAGGTTGATCAAGAGAGAGACGATCCCTCGTATCAGCCAAAGCACGAGGAAGCTCTTCTCCACCGAAGCATCTTCTTCT
TTCGCTGAGAGACTCAGAAACCTTCCCAAAGATTTCCCCTCCACTCAGGCTAAACGCGATGCTTCTCTGCTCATTGGAAGAACTCC
TCTCGTGTTTCTCAACAGAGTCACTGAAGGATGTGAAGCTTATATTGCAGCCAAGCAAGAACATTTCCAGCCTACTTGTAGCATCA
AGGACAGACCAGCTTTAGCTATGGTTGCAGATGCAGAGAAGAAAAATCTTATCACTCCTGGAAAAACAACATTGATAGAACCTACT
TCAGGAAACATGGGAATAAGTATGGCTTTCATGGCGGCTATGAAAGGGTACAGGATTATAATGACAATGCCTTCTTACACCAGTTT
GGAGAGGAGAGTGACTATGAGATCATTTGGTGCTGAGCTTGTCCTCACTGATCCAACCAAAGGAATGGGTGGAACCGTTAAGAAAG
CTTATGATCTCCTTGAGAGTACTCCTGATGCTCACATGTTGCAACAGTTTGCTAATCCAGCAAACACTCAGATTCATTTTGATACA
ACTGGTCCTGAGATTTGGGAAGATACACTTGGGAATGTTGATATCTTTGTGATGGGAATTGGTAGTGGGGGCACTGTCTCTGGTGT
TGGCCAATACCTTAAGTCTAAAAACCCTAATGTCAAGATATATGGAGTGGAGCCTGCTGAAAGCAACATACTCAACGGTGGCAAGC
CAGGTCCACATGCTATCACAGGCAATGGGGTTGGATTTAAACCGGATATATTGGATATGGATGTTATGGAGAGTGTTCTTGAGGTT
AGTAGTGAGGATGCTATAAAGATGGCTAGAGAATTGGCATTGAAAGAAGGTCTCATGGTTGGAATATCCTCTGGGGCTAACACTGT
GGCAGCAATTAGACTGGCCAAAATGCCAGAGAACAAAGGCAAACTAATTGTGACTATTCATGCGAGCTTTGGAGAGAGATATCTGT
CATCTGTTCTGTTTGATGAGATTAGGAAAGAAGCAGAAGCGATGAAGCCAGTTTCAGTGGACTGATTTGGTTTTGGTTTGGGTTGA
TATGAAGAAAAACTCTTTACTATATAATCTTCATCTTGCGGCACAAGATTGTGACACAACCCACCAAAAAGTGTCATAAATAATAT
ATGCTTGTTTTATATTGATGTTGAATACTGGAAGAATAATTATGTTAATGTTTGATATTGAAAATAAAAGCTTTTTCTGGTT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_191703 cysteine synthase C1 [Arabidopsis thaliana]17263e-190
XP_002876613 beta-substituted ala synthase 3_1 [Arabidopsis lyrata subsp. lyrata]17211e-189
XP_002301362 predicted protein [Populus trichocarpa]15193e-166
ABK95519 unknown [Populus trichocarpa]15131e-165
XP_002320141 predicted protein [Populus trichocarpa]14988e-164

Swiss-Prot top hits (Blast detail)Scoree value
P32260 Cysteine synthase, chloroplastic/chromoplastic10843e-117
O81155 Cysteine synthase, chloroplastic/chromoplastic10566e-114
Q9XEA8 Cysteine synthase10441e-112
Q43725 Cysteine synthase, mitochondrial10422e-112
Q00834 Cysteine synthase10342e-111

TrEMBL top hits (Blast detail)Scoree value
Q9S757 Cysteine synthase17262e-190
B9GQA5 Cysteine synthase15192e-166
A9PGL6 Cysteine synthase15131e-165
B9I8L3 Cysteine synthase (Fragment)14985e-164
A5AEP0 Cysteine synthase14977e-164

Arabidopsis top hits (Blast detail)Scoree value
AT3G61440.1 CYSC1 (CYSTEINE SYNTHASE C1); L-3-cyanoalanine synthase/ cysteine synthase17278e-193
AT3G61440.2 CYSC1 (CYSTEINE SYNTHASE C1); L-3-cyanoalanine synthase/ cysteine synthase13272e-146
AT3G59760.1 OASC (O-ACETYLSERINE (THIOL) LYASE ISOFORM C); ATP binding / cysteine synthase10432e-113
AT3G59760.3 OASC (O-ACETYLSERINE (THIOL) LYASE ISOFORM C); ATP binding / cysteine synthase10422e-113
AT4G14880.1 OASA1 (O-ACETYLSERINE (THIOL) LYASE (OAS-TL) ISOFORM A1); cysteine synthase10172e-110

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
118  38%
 
121  5%
 
86  29%
 
72  10%
 
212  10%
 
61  5%
 
101  5%

Unigene MembersMember information