Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN00374

FASTA Sequence
Unigene ID: UN00374Length: 992 SSR 
GGATAAATAAATAATAAAAAAAGAGAGGAGAGGGAATAAGGAGGAGTCGAATCGAAGGTCGATCGATCAATCAATAGAGGAGGAGG
AGGAGCAGCAGATCTGTGGCCGTCCGCCGTGCAGTAATTATGGGCGTTATTAAATTTGGAGTCTTCCTCTTCCTCTTCCTCTTGGG
GCTGACCACCTGTGATGCTTCTCTTCCCCAACCATCTGCTGATGATAACCAAGTTTGTGAGTTGTGTGATAAGTATCTCACCCTCG
CCATTGATTACCTCCAAAATGACGACAACCAGAATGCACTCGTTGAGGCCCTCCACATGACCTGCTCCCAGATTCCTCCTTTGCAA
AAACAGTGTCTTTCCATGGTAGATCATTATACCCAACTTTTCTTCACTCGAGTCTCTCTTCTCAACCCCCACGGCATCTGCAAAAC
CCTTAACCTCTGTCAACCACTCCTTGCTTCCCAAGGAAACTGTGAGGCTTGCCACGATACTGTCTCCCAGCTTGTCACCAAACTCA
AGGATCCTCAAACTAAGCTCAAGATAATTCGCTTGCTTCTCAAGGAATGCAAGTCCCTCAACAATTACCAGGACAAGTGCAAGAAG
ATGGTGTTCGAGTACGGCCCACTGATGCTTGCCGATTTCGAAAATTTTCTGGAAAAGAAAGACGTCTGTTCTATCCTTGGCGTCTG
TCCACCTCCACCCATCCACAGTTTCTACATCCTTCCTGCAGCGCTGGCAGATTCTTAAATTTGACCACCCTTTCTTTTTCTTTTTA
CCTTCATTCCCTTGGTAACAATAACATTCTCACAGAAAGGTTTTCATGTTTTGGATAACCGTTGGGTGTTTACTATACATTGATGG
GCTTCTCTGGCCCAGTTTCTTAATGGGCTTTGCTTGGTGTTCATTCTCGCATTGTTTGATATGTAATGTTTGCCTCTGAAGCTTCA
AATGAAGCAGGCTTGGCTTTTGTTTTTTCCTTTTTTATTTAAAGTC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002872994 saposin B domain-containing protein [Arabidopsis lyrata subsp. lyrata]7395e-076
NP_195800 saposin B domain-containing protein [Arabidopsis thaliana]7351e-075
BAJ33968 unnamed protein product [Thellungiella halophila]4474e-042
NP_190741 saposin B domain-containing protein [Arabidopsis thaliana]4448e-042
XP_002876101 predicted protein [Arabidopsis lyrata subsp. lyrata]4393e-041

Swiss-Prot top hits (Blast detail)Scoree value
P10960 Sulfated glycoprotein 11253e-006
Q61207 Sulfated glycoprotein 11211e-005

TrEMBL top hits (Blast detail)Scoree value
Q9LZW6 AT5g01800/T20L15_707351e-075
Q9SCT5 AT3g51730/T18N14_1104445e-042
B9T649 Putative uncharacterized protein4275e-040
C6T5S5 Putative uncharacterized protein4015e-037
B9HDA3 Predicted protein4007e-037

Arabidopsis top hits (Blast detail)Scoree value
AT5G01800.1 saposin B domain-containing protein7364e-078
AT3G51730.1 saposin B domain-containing protein4443e-044

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
63  20%
 
81  7%
 
93  20%
 
114  27%
 
73  20%
 
201  7%

Unigene MembersMember information