Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN00989

FASTA Sequence
Unigene ID: UN00989Length: 461 SSR 
CCCACCAACGGCATTACTAAAATCAAGATCAAAGAGGAAGGGACTATCTGTCGTTCTTGTTCTACGTGATTCACAATAAAATGTTC
ACGTGAAAGGCAAAAAAAAAGAGAGAGAGAGAGAGATGGGGGAAGTGAAACAAACACAACTTTCTACTGACAACACTTCATCTCAG
GAGAATTTGTTCTTTTGAGTTTCATTTCAAACAGCAGGCCATTCTTTACGGATGTCGAAGCTGTAGTTGATCTCCAAGTAGCACTT
GTTATCATCATCAAAAAACTTAGTTCTTGCAAAATATGATCCTCTAGCAAACATGCCTGAAGGAGTGGTCTCTTCAGGCATCACGT
GGTTGTATGGCTCCAACTGAGGACTAAAGGTTCCAAGCATTTCCTTTCCTCTGTCCACTTTAACACCAGTCTTCCAAACTGTATTG
GTGTACCTAAGACCAGAGACAATGTTGTTGC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002882555 rho GDP-dissociation inhibitor family protein [Arabidopsis lyrata subsp. lyrata]4512e-043
NP_187445 Rho GDP-dissociation inhibitor 1 [Arabidopsis thaliana]4484e-043
XP_002454382 hypothetical protein SORBIDRAFT_04g029740 [Sorghum bicolor]4109e-039
ACG30128 hypothetical protein [Zea mays]4082e-038
NP_001152323 rho GDP-dissociation inhibitor 1 [Zea mays]4082e-038

Swiss-Prot top hits (Blast detail)Scoree value
Q9SFC6 Rho GDP-dissociation inhibitor 14483e-044
Q95UQ1 Putative rho GDP-dissociation inhibitor 12101e-016
P52566 Rho GDP-dissociation inhibitor 21931e-014
P19803 Rho GDP-dissociation inhibitor 11875e-014
Q99PT1 Rho GDP-dissociation inhibitor 11875e-014

TrEMBL top hits (Blast detail)Scoree value
Q541X0 Putative RHO GDP-dissociation inhibitor 14482e-043
C5XZU8 Putative uncharacterized protein Sb04g0297404106e-039
B6SZ45 Putative uncharacterized protein4081e-038
B6UCD5 Rho GDP-dissociation inhibitor 14081e-038
C0PMC1 Putative uncharacterized protein4081e-038

Arabidopsis top hits (Blast detail)Scoree value
AT3G07880.1 Rho GDP-dissociation inhibitor family protein4492e-045
AT1G62450.1 Rho GDP-dissociation inhibitor family protein3848e-038
AT1G12070.1 Rho GDP-dissociation inhibitor family protein3391e-032

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
101  50%
 
91  50%

Unigene MembersMember information