Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN01482

FASTA Sequence
Unigene ID: UN01482Length: 707  SNP
TCGTATTTGCGAGTTTACTGGAACGAAGATCATCTTCTACGATCTAAGGGGGCCATTTATTGAGAATCTGTACAAGCCAAGTGTTT
CTCAATCAAGATTGGAAGCATTAATCGAAGCCCTTGACACGGAACTTGGGCAGCTATGCAGTGTCATAATGGAACCATTGAGGGAT
CGGATAGTCACAAGCTTGCTTCAAGCATCACTTGACGGATTACTTCGCGTACTATTAGACGGAGGCTCGTCACGTGTATTTCATCC
AAGCGAGTCAAAGCTACTTGAAGAAGATGTAGAGGTCTTAAAGGAATTCTTTATTTCTGGCGGTGACGGACTTCCGAGAGGAGTCG
TTGAAAACCAAATCGCCCGTGTTCGTCTCGTTGTAAAGCTGCACGGATACGAGACACGAGAGCTTATCGATGACTTAAGGTCTAGA
AGCAGTCTAGATATGCAGCAAGGAGGAAGAGGCAAACTTGGAGCAGACACCCAAACACTGGTGCGAGTGTTGTGCCACAGAAACGA
TTCAGAGGCTTCTCTGTTTCTGAAAAAGCAGTACAAAATCCCCAAATCCCACGCCTAATCGGATATTATGCTTTCATCTATTGGCC
CCTTCTTTTAGTTTCTTATTTTCTTCTTGTTCAGTGACAAAAATACTTCTGTATAAACGATGATTTTCACAAGCACAGGCTGTAGA
GAAATTACAGTTTCACTCG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002873288 hypothetical protein ARALYDRAFT_487516 [Arabidopsis lyrata subsp. lyrata]9095e-096
BAB11155 unnamed protein product [Arabidopsis thaliana]9051e-095
NP_196314 uncharacterized protein [Arabidopsis thaliana]9051e-095
XP_002513024 conserved hypothetical protein [Ricinus communis]7796e-081
CBI35103 unnamed protein product [Vitis vinifera]7383e-076

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q8RX56 AT5g06970/MOJ9_149051e-095
Q9FL49 Similarity to unknown protein9051e-095
B9RG72 Putative uncharacterized protein7794e-081
B9FAM2 Putative uncharacterized protein6451e-065
Q10F28 Expressed protein6451e-065

Arabidopsis top hits (Blast detail)Scoree value
AT5G06970.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Munc13 homology 1 (InterPro:IPR014770), Protein of unknown function DUF810 (InterPro:IPR008528), Munc13 homology 2 (InterPro:IPR014772); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G11670.1); Has 138 Blast hits to 130 proteins in 39 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 43; Plants - 89; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).9065e-098
AT4G11670.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Munc13 homology 1 (InterPro:IPR014770), Protein of unknown function DUF810 (InterPro:IPR008528), Munc13 homology 2 (InterPro:IPR014772); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G06970.1); Has 147 Blast hits to 87 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 138; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).3133e-029
AT2G25800.1 INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Munc13 homology 1 (InterPro:IPR014770), Protein of unknown function DUF810 (InterPro:IPR008528), Munc13 homology 2 (InterPro:IPR014772); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G20010.2); Has 242 Blast hits to 156 proteins in 35 species: Archae - 0; Bacteria - 8; Metazoa - 36; Fungi - 18; Plants - 94; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).2292e-019
AT2G20010.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Munc13 homology 1 (InterPro:IPR014770), Protein of unknown function DUF810 (InterPro:IPR008528), Munc13 homology 2 (InterPro:IPR014772); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G25800.1); Has 93 Blast hits to 88 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 90; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).2246e-019
AT2G20010.2 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Munc13 homology 1 (InterPro:IPR014770), Protein of unknown function DUF810 (InterPro:IPR008528), Munc13 homology 2 (InterPro:IPR014772); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G25800.1); Has 94 Blast hits to 89 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 91; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).2246e-019

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
96  60%
 
121  10%
 
113  30%

Unigene MembersMember information