Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN01946

FASTA Sequence
Unigene ID: UN01946Length: 539 SSR 
GATAAATAAGATAGAGAACCATAGAAGAAGAAGAAGAAATTACATCATTCCAAGTTATTATATTACAAAGAAGGCAAGTAAAGGAA
GGTTAGATATTACATCGCATCAAAAGGTAATTTACCACGTTCATTTGTTATCGTTCTTCTCTAAATTAATATTAGACACATCATTC
CCAAGTTATTACCAGCTGAAGTGCTTACTCAAACACAAACGTGCAAGAATCTCTGGCCACACATTCCAATTCCTTCAACATCCCCT
GCTTCTCTGCCGATTCTGAGTAAAAAGCTGCCTTCTTTAGATGACTCCCATTGGCTAGAATGTACTTTGCAGCTTCTCTCTCTGTC
TCTGTGCCCTTGTATTGTCTCCACTCAAAGATCTCAAGATGAGATGATAAACATTCAGGAACAAAACTTGGTTTGTTCCATGAAAC
CATCCCGTCGTGCTGGACACAGTGTTCCTGAAACAAATTGAGCTTGAGAACTCTAAGCCTGGGTGCATCATTGAGTATAAGGGTAA
GTAGATTCCACCAGTCCGAAGAG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_683416 FBD-like domain family protein [Arabidopsis thaliana]3951e-036
XP_002894291 predicted protein [Arabidopsis lyrata subsp. lyrata]3951e-036
NP_175511 putative FBD-associated F-box protein [Arabidopsis thaliana]3251e-028
NP_200491 FBD and LRR domain-containing protein [Arabidopsis thaliana]3035e-026
ABK28762 unknown [Arabidopsis thaliana]3035e-026

Swiss-Prot top hits (Blast detail)Scoree value
Q9C6I2 Putative FBD-associated F-box protein At1g509803257e-030
Q9FJV2 Putative FBD-associated F-box protein At5g565602371e-019
Q9FJV1 F-box/FBD/LRR-repeat protein At5g565702316e-019
Q9LXJ6 F-box/FBD/LRR-repeat protein At3g526802272e-018
Q8LF09 F-box/FBD/LRR-repeat protein At4g001602163e-017

TrEMBL top hits (Blast detail)Scoree value
Q3E7S7 Putative uncharacterized protein At1g51055.13992e-037
A0MFP8 Putative uncharacterized protein (Fragment)3033e-026
Q9FJT3 Emb|CAB62440.13033e-026
Q9LQM1 F5D14.14 protein2236e-017
Q9FFW3 Genomic DNA, chromosome 5, P1 clone:MBB182173e-016

Arabidopsis top hits (Blast detail)Scoree value
AT1G51055.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: FBD (InterPro:IPR013596), FBD-like (InterPro:IPR006566); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G56800.1); Has 247 Blast hits to 244 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 247; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).4002e-039
AT1G50980.1 F-box family protein3258e-031
AT5G56800.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: FBD (InterPro:IPR013596), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G56560.1); Has 519 Blast hits to 504 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 515; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).3042e-028
AT5G56560.1 F-box family protein2389e-021
AT5G56570.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: FBD (InterPro:IPR013596), Cyclin-like F-box (InterPro:IPR001810), FBD-like (InterPro:IPR006566); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G56560.1); Has 445 Blast hits to 429 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 440; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).2325e-020

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
81  50%
 
61  50%

Unigene MembersMember information