Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN02298

FASTA Sequence
Unigene ID: UN02298Length: 463 SSR 
GAGCTAGGAAGAAAGAACTAACACTTTGATTGCATTCAAAAATAAACTTGTCTTTCAGGCTAACATCAATAATAAATAATATCCAA
GAAAACAAAATAATGGAACTACTACAAATCTTTTACTGGTATGATCTTTCTGTTCGCATTGTTGCATGCTATATATTACCTTATGT
AACCTTAAAAGTCTTCTTCTTCTTCTCTCCGTCTCCATTACGGAATCCAGAATGTGCGTAATATATTAGGTAATTTCATCAAATGT
TGAGAGGATCATCTTCTGTGTTTCTTTCATTAAGAGGTGTCCAATCATTTGTCTTTGGCTTGTCAGTAATCATCATGAGCCTTCTT
TGCAGGAGACTTGCAATAAAGAGGAAGACGGAGCACATTCCAAACATGACAGTCATAGGGAACGCATTCACATTGTACAAGACAAC
ACAGACAAAGATGTTCAGAGGAATCCGGAAAAA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_567786 major facilitator protein [Arabidopsis thaliana]3516e-032
XP_002869545 hypothetical protein ARALYDRAFT_913755 [Arabidopsis lyrata subsp. lyrata]3516e-032
XP_002515682 conserved hypothetical protein [Ricinus communis]3086e-027
NP_190500 major facilitator protein [Arabidopsis thaliana]3005e-026
CAB66410 putative protein [Arabidopsis thaliana]3005e-026

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q9C5R0 AT4g27720/T29A15_2103514e-032
B9RPL3 Putative uncharacterized protein3084e-027
Q0WQ56 Putative uncharacterized protein At3g493103004e-026
Q9CA11 At3g493103004e-026
Q9M3A1 Putative uncharacterized protein F2K15.1703004e-026

Arabidopsis top hits (Blast detail)Scoree value
AT4G27720.1 LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF791 (InterPro:IPR008509), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G64650.1); Has 496 Blast hits to 491 proteins in 183 species: Archae - 5; Bacteria - 234; Metazoa - 75; Fungi - 33; Plants - 96; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).3524e-034
AT3G49310.1 LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF791 (InterPro:IPR008509), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27720.1); Has 550 Blast hits to 545 proteins in 201 species: Archae - 5; Bacteria - 285; Metazoa - 85; Fungi - 33; Plants - 99; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink).3013e-028
AT1G64650.1 LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF791 (InterPro:IPR008509), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27720.1); Has 565 Blast hits to 562 proteins in 197 species: Archae - 7; Bacteria - 312; Metazoa - 76; Fungi - 39; Plants - 85; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink).2531e-022
AT1G64650.2 LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF791 (InterPro:IPR008509), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27720.1); Has 548 Blast hits to 545 proteins in 182 species: Archae - 5; Bacteria - 298; Metazoa - 76; Fungi - 38; Plants - 85; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink).2531e-022

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
72  100%

Unigene MembersMember information