Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN02998

FASTA Sequence
Unigene ID: UN02998Length: 508 SSR 
GGGGGAAGTAGCTAGTATAGAGAGAGAGAGATAGAAGAAAGAAGGGAAGCTGACGGTCGAGAGAGAGACTTTTCGGACAGCAACTG
CTGATTTCTCGCCGATCTTGCAGTTCGAGCAAGACCCTGTTCAGATTCTTGATGCTTTGTTGCCTTTGTATCTGAACAGTCAGATT
CTTAGGGCTTTACAGGAGTCTTTGGCGAGTGAGCTCGCGGCTCGGATGAGTGCGATGAGTAGTGCTTCGGATAATGCATCGGATCT
TAAGAAATCGCTTTCGATGGTTTATAATAGAAAACGTCAAGCTAAGATTACTGGTGAGATTCTTGAGATTGTTGCTGGAGCCTATG
CACAGGCTTGATGATTCGATATGAGCAGACTCTTTTTAAATATATATATCATTTTCGGTCGTATAATGTATAATCGTTTAGAACTC
CTGTGATCTTTATATAATGATGCAATTACAAACATAATGCGGTTGTATTTATTTTGGTCTTTCATTGGATAAGTGATT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_567265 ATP synthase gamma chain 1 [Arabidopsis thaliana]4835e-047
BAH20433 AT4G04640 [Arabidopsis thaliana]4835e-047
CAB52365 ATP synthase gamma chain, chloroplast precursor [Arabidopsis thaliana]4763e-046
XP_002874807 hypothetical protein ARALYDRAFT_911722 [Arabidopsis lyrata subsp. lyrata]4763e-046
XP_002305572 predicted protein [Populus trichocarpa]4389e-042

Swiss-Prot top hits (Blast detail)Scoree value
Q01908 ATP synthase gamma chain 1, chloroplastic4833e-048
P29790 ATP synthase gamma chain, chloroplastic4351e-042
P0C1M0 ATP synthase subunit gamma, chloroplastic4109e-040
P28552 ATP synthase gamma chain, chloroplastic4044e-039
P05435 ATP synthase gamma chain, chloroplastic4044e-039

TrEMBL top hits (Blast detail)Scoree value
B9DI66 AT4G04640 protein (Fragment)4834e-047
Q9SUI9 ATP synthase gamma chain (Fragment)4763e-046
A9PJJ6 ATP synthase gamma chain4386e-042
B9H1A7 ATP synthase gamma chain4386e-042
B9RXK8 ATP synthase gamma chain4332e-041

Arabidopsis top hits (Blast detail)Scoree value
AT4G04640.1 ATPC1; enzyme regulator4842e-049
AT1G15700.1 ATPC2; enzyme regulator3732e-036
AT2G33040.1 ATP synthase gamma chain, mitochondrial (ATPC)1501e-010

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
91  50%
 
121  50%

Unigene MembersMember information