Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN04137

FASTA Sequence
Unigene ID: UN04137Length: 1425  SNP
CCCGGTTCGCTTCACTGAATATTCAAATAAGCGTATCTTCTCTTCAACTAGCGAGAGAAGTTGACCAAACACACGGAAACAGAAAC
AAAGTAGAACATACTAAGATAGATGAACAAATGTAGCCAATAGTTCTCAGATTCTTATTCCCCATTATATAAAGGGGGTTTTATTA
TTGAGTTTCTAAAGCAGTTCTTTTAGTTTCCGTAAGTTAAGATCACTTGGTAGTATTGTTTCCTGTAGTGGCGGGAGGCCAAGGCG
CTCCAGCCATCACAGCTTCGATCTCCCACGTCTCCCTTGGAACATTCGTCATGTTCTTGCAGCCATTCGCAGTAACGACCAAATCG
CTTTCGATTCTGACACCTCCTATGTTCTTGAATCTCTCTATTGTTTCACGGTTGAAGAACTTGGAGGTTTTTGCGTTTTCCATGGC
TGGGATTAGCAATGCCTTGATGAAATAGCATCCTGGCTCCACCGTTATTACCATTCCTTCAAGGAGATCTCTTGCAGTGCGTAATG
ACTTCAGTCCCGGTTCCTTTGGTCTTTCCACTCCCATTGGATAACCACCGGTATCGTGTGTGTCAATGCCCATGAAGTGACCTAGT
CCATGAGGCATGAAAACAGCTCCCAAACGTTCTACCATCATCTCGTCCACATCACCAGTGAGGATGGACCCCTTCTTCAGTGACTC
AAGGATGATTCTTTCGGCTAGCTTGTGCATATCCACCCAGTTAACTCCTGGCTTCATTGCAGAGATTACAGAATTATGTGCTTTCA
GAACAGCATTGTAGATTAGACTCTGGTCACTTGTAAATTTACCATTGACGGGGAATGAGCATGTTATGTCAGATGCATAAAAATGG
TATTCACCACCCATATCAAGCAATGCCAGATCTCCATCTTCAAAAGTCCTATCATTTGGAGCTGCAGCGTGCCCATAATGAAGAAC
AGCACTATTATCCCCTGTCGCGCAGATGCATGTGTACGAGCAGTGCCTACAGCCACCGTACATGTAGGTGTGGTGCAAAAACATAC
TTTCCATCTGATATTCTTTCATGCCAGGTGTGACTCTCCTCATAACCTCTACATGAGCTTCGGAACTTATATCATTTGCAAATTGT
AGTAGCTGAAGCTCCAAACTTGATTTGGTAACTCGACATTCCGCCAAAATAGGATGCAAAGTAGTCAAATCAGTCTCAAACTTTTC
TATCCCCTCAAAGCTGGCAGGTTTGGATAAGTTTCCGCTGTCGGTGTTAAGACCATGGAGAAGATACAACAGGGGCTTTCCAGATC
CCTTAAACTGTTCACTCAAGACGTGGATAATCTCATCAACGGTAAACCATGTCAACCATATAGGTTTCCTTAAAGTGCGACAATGG
CTTTATCTCCCCTAACCATACAGCATAATCCTCAGGCAACCTTGGAATC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002869430 X-Pro dipeptidase [Arabidopsis lyrata subsp. lyrata]18186e-201
NP_194678 Xaa-Pro dipeptidase [Arabidopsis thaliana]18142e-200
AAM97085 X-Pro dipeptidase-like protein [Arabidopsis thaliana]18105e-200
CBI27943 unnamed protein product [Vitis vinifera]16441e-180
XP_002282779 PREDICTED: hypothetical protein [Vitis vinifera]16441e-180

Swiss-Prot top hits (Blast detail)Scoree value
P12955 Xaa-Pro dipeptidase11193e-121
Q5I0D7 Xaa-Pro dipeptidase11184e-121
Q11136 Xaa-Pro dipeptidase11122e-120
Q5RFB3 Xaa-Pro dipeptidase11005e-119
Q55E60 Xaa-Pro dipeptidase9591e-102

TrEMBL top hits (Blast detail)Scoree value
Q0WUQ7 Putative prolidase18141e-200
Q8L780 X-Pro dipeptidase-like protein18104e-200
Q6Z8B5 Os02g0224400 protein15433e-169
C5XYG3 Putative uncharacterized protein Sb04g00796015335e-168
C6TAJ8 Putative uncharacterized protein15245e-167

Arabidopsis top hits (Blast detail)Scoree value
AT4G29490.1 aminopeptidase/ manganese ion binding18147e-203
AT1G09300.1 metallopeptidase M24 family protein2707e-024
AT1G09300.2 metallopeptidase M24 family protein2707e-024

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
95  42%
 
82  17%
 
111  8%
 
201  8%
 
62  17%
 
121  8%

Unigene MembersMember information