Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN05110

FASTA Sequence
Unigene ID: UN05110Length: 647 SSR 
GGACTCGACAGTCAACTAGGGTTTACCGGAAACCTCAGAGAGACACGACGACGCTCTCTCTCTCTCTCTCTCTCTACTCTGGCTGC
TTACTGATCCGAAGGTGAAATGGCGCTGCGACATCTGAGCCGGCCGAGAGACATCGTAAAGAGATCGACGAAGAAGTACCTCGACG
AACCCCTTTACCATCGTCTCTTCAAGGACGGCGGATCCGAGGTCAATGTTCGTCAGCAGCTCAATCAGTTCCTCAAGGGCACTAAA
CACGTCTTCAAATGGGAAGTCGGAGACACGATCAAGAAGCTCCGTAGCCGCGGCCTCTATTACCCCGCTCTCAAGCTCTCTGAAGT
AATGGAACATAGAGGTATGAACAAGACGGTGAGTGACCAAGCAATCCATCTCGATCTCGTTGCCAAAGCTCGTGGAATCACAGCGG
GAGAGGCTTACTTTGTCGCTCTTCCGGAGACATCTAAGACCGAGCTCACCTACGCCTCTCTTCTGAACTGCTACTGCAAGGAGCTG
GTGACAGAGAAAGCGGAAGGTTTATTGAGCAAGATGAAAGAGCTCAACATCACTGTTAGCTCCATGTCCTACAACAGCCTCATGAC
TCTTTACACAAAGACGGGACGGGCCGAGAGGGTTCCGGGGGTGAT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002886593 pentatricopeptide repeat-containing protein [Arabidopsis lyrata subsp. lyrata]8306e-087
NP_176276 pentatricopeptide repeat-containing protein [Arabidopsis thaliana]8144e-085
XP_002527905 pentatricopeptide repeat-containing protein, putative [Ricinus communis]6622e-067
XP_002331159 predicted protein [Populus trichocarpa]6569e-067
XP_002267979 PREDICTED: hypothetical protein [Vitis vinifera]6309e-064

Swiss-Prot top hits (Blast detail)Scoree value
O22714 Pentatricopeptide repeat-containing protein At1g607708142e-086
Q93WC5 Pentatricopeptide repeat-containing protein At4g01990, mitochondrial2335e-019
Q84JR3 Pentatricopeptide repeat-containing protein At4g21705, mitochondrial2319e-019
Q9FZ24 Pentatricopeptide repeat-containing protein At1g02370, mitochondrial2282e-018
Q8LPS6 Pentatricopeptide repeat-containing protein At1g021502254e-018

TrEMBL top hits (Blast detail)Scoree value
B9SPI6 Pentatricopeptide repeat-containing protein, putative6621e-067
A9PHB6 Predicted protein6566e-067
A2XFN0 Putative uncharacterized protein5662e-056
Q01M49 H0107B07.5 protein5662e-056
Q7XTG6 OSJNBa0041M06.2 protein5662e-056

Arabidopsis top hits (Blast detail)Scoree value
AT1G60770.1 pentatricopeptide (PPR) repeat-containing protein8142e-087
AT4G01990.1 pentatricopeptide (PPR) repeat-containing protein2335e-020
AT4G21705.1 pentatricopeptide (PPR) repeat-containing protein2318e-020
AT1G02370.1 pentatricopeptide (PPR) repeat-containing protein2282e-019
AT1G02150.1 pentatricopeptide (PPR) repeat-containing protein2254e-019

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
121  50%
 
101  50%

Unigene MembersMember information