 |
Information for unigene UN05110
FASTA Sequence |
Unigene ID: UN05110 | Length: 647 |
SSR | | GGACTCGACAGTCAACTAGGGTTTACCGGAAACCTCAGAGAGACACGACGACGCTCTCTCTCTCTCTCTCTCTCTACTCTGGCTGC
TTACTGATCCGAAGGTGAAATGGCGCTGCGACATCTGAGCCGGCCGAGAGACATCGTAAAGAGATCGACGAAGAAGTACCTCGACG
AACCCCTTTACCATCGTCTCTTCAAGGACGGCGGATCCGAGGTCAATGTTCGTCAGCAGCTCAATCAGTTCCTCAAGGGCACTAAA
CACGTCTTCAAATGGGAAGTCGGAGACACGATCAAGAAGCTCCGTAGCCGCGGCCTCTATTACCCCGCTCTCAAGCTCTCTGAAGT
AATGGAACATAGAGGTATGAACAAGACGGTGAGTGACCAAGCAATCCATCTCGATCTCGTTGCCAAAGCTCGTGGAATCACAGCGG
GAGAGGCTTACTTTGTCGCTCTTCCGGAGACATCTAAGACCGAGCTCACCTACGCCTCTCTTCTGAACTGCTACTGCAAGGAGCTG
GTGACAGAGAAAGCGGAAGGTTTATTGAGCAAGATGAAAGAGCTCAACATCACTGTTAGCTCCATGTCCTACAACAGCCTCATGAC
TCTTTACACAAAGACGGGACGGGCCGAGAGGGTTCCGGGGGTGAT
|
|
|
GenBank top hits (Blast detail) | Score | e value |
XP_002886593 pentatricopeptide repeat-containing protein [Arabidopsis lyrata subsp. lyrata] | 830 | 6e-087 |
NP_176276 pentatricopeptide repeat-containing protein [Arabidopsis thaliana] | 814 | 4e-085 |
XP_002527905 pentatricopeptide repeat-containing protein, putative [Ricinus communis] | 662 | 2e-067 |
XP_002331159 predicted protein [Populus trichocarpa] | 656 | 9e-067 |
XP_002267979 PREDICTED: hypothetical protein [Vitis vinifera] | 630 | 9e-064 |
Swiss-Prot top hits (Blast detail) | Score | e value |
O22714 Pentatricopeptide repeat-containing protein At1g60770 | 814 | 2e-086 |
Q93WC5 Pentatricopeptide repeat-containing protein At4g01990, mitochondrial | 233 | 5e-019 |
Q84JR3 Pentatricopeptide repeat-containing protein At4g21705, mitochondrial | 231 | 9e-019 |
Q9FZ24 Pentatricopeptide repeat-containing protein At1g02370, mitochondrial | 228 | 2e-018 |
Q8LPS6 Pentatricopeptide repeat-containing protein At1g02150 | 225 | 4e-018 |
TrEMBL top hits (Blast detail) | Score | e value |
B9SPI6 Pentatricopeptide repeat-containing protein, putative | 662 | 1e-067 |
A9PHB6 Predicted protein | 656 | 6e-067 |
A2XFN0 Putative uncharacterized protein | 566 | 2e-056 |
Q01M49 H0107B07.5 protein | 566 | 2e-056 |
Q7XTG6 OSJNBa0041M06.2 protein | 566 | 2e-056 |
Arabidopsis top hits (Blast detail) | Score | e value |
AT1G60770.1 pentatricopeptide (PPR) repeat-containing protein | 814 | 2e-087 |
AT4G01990.1 pentatricopeptide (PPR) repeat-containing protein | 233 | 5e-020 |
AT4G21705.1 pentatricopeptide (PPR) repeat-containing protein | 231 | 8e-020 |
AT1G02370.1 pentatricopeptide (PPR) repeat-containing protein | 228 | 2e-019 |
AT1G02150.1 pentatricopeptide (PPR) repeat-containing protein | 225 | 4e-019 |
EST library breakdown for ESTs in the assembly |
Library |
ESTs | Percentage of ESTs in assembly |
|
|
|
|