Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN05248

FASTA Sequence
Unigene ID: UN05248Length: 1268 SSRSNP
GGGAAAGATCGTTTTATTAGAGAGAAGAACTAAGCTGCGACGGAGGAGACGGAAGAAGAAGAAGAAGAAGAAGAGAATGGCGGCGA
ATGAAGAAGAAGCGGTGAAGTATGTATGGGAAGGAGCAATTCCGCTGCAGATCCATCTCCACAAATCCGAAGTCGCTTCTCACCCT
GCTCCTCCTCCTGCTCTCGTATTAGCACCTAGGATAGGGTACTTGCCTCTGTTAGTTCCTCTTATAAAGCCTTACTTCAAGGATTC
ACTTCCTCCTGGTGAAGATTCCATCTGGTTCGATTACAAAGGCTTTCCTCTTAAATGGTATATACCAACAGGTGTTCTTTTTGATC
TCATATGCGCAGAACCTGAAAGACCTTGGAATCTCACCATACACTTTAGGGGATATCCTAGCAACGTGCTGATTCCATGTGAAGGA
GAAGATTCTGTCAAGTGGAACTTTGTTAATTCTTTGAAAGAGGCGGCGTATATCATCAATGGAAACTGCAAGAATGTTATGAATAT
GTCTCAGAGTGATCAAGAGGATCTATGGACCTCTGTCATGAACGGTGATCTTGAGTCCTACACAAGATTATTACCCAAGCTTAAAA
TGGGAAATATCGAAGATGAGTTTTCAAGAAAAGCAAATTTGTCATCTCCACAATCTCGACAAGGTGGGACTGAGACAGATGTGGCT
GGACAAGTTAAGACAGCGAGGATTCCTGTTCGGCTGTATGTTCGAAGTGTCAATAAAGATTTCGAGAATCTTGAAGATGTACCTGA
GATCGATACATGGGATGAGATCTCGTACTTGAATCGCCCTGTTGAGTTCCTCAGAGAAGAAGGGAAATGCTTTACTCTACGTGACG
CCATTGAAAGTCTCCTCCCGGAGTACAGTGGAGACAGAGCTCAAACGAGTGGAGAAGAGGAAGCAGATGGGTCGCAGGAGACGAGG
GGAGAAGTCAAACTGGTAAGGATCCAAGGGATAGAAGTGAGACTAGAGATACCGTTTTCATGGGTGGTAAATAACTTGATGAACCC
AGAATTCTATCTCCACATCTCTGTTCTTGTGAAAGCTCCTCAAAGGTAAAACTAGCAAGACGCTGCATCTACACTCCCATCTGTGA
ATCGATCAAATTGCTTTCTAGTTTTTTTCTCAGAAGCCTAAAGAATCAACTTGTTTTATATGCAACCACTACTATTACTCTGATGG
AAGCAGAACTCAGATATACATTTGAAATCATATTAATGATTCATTCATAGCGTTTACTTGTTAA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_197231 autophagy protein 5 [Arabidopsis thaliana]15937e-175
XP_002873820 APG5/ATG5 [Arabidopsis lyrata subsp. lyrata]15883e-174
XP_002526586 conserved hypothetical protein [Ricinus communis]10864e-116
CAN83659 hypothetical protein VITISV_004197 [Vitis vinifera]10462e-111
XP_002276604 PREDICTED: hypothetical protein [Vitis vinifera]10391e-110

Swiss-Prot top hits (Blast detail)Scoree value
Q9FFI2 Autophagy protein 515933e-176
A2X052 Autophagy protein 58711e-092
Q6ZGL4 Autophagy protein 58612e-091
Q99J83 Autophagy protein 52922e-025
Q9H1Y0 Autophagy protein 52913e-025

TrEMBL top hits (Blast detail)Scoree value
B9SKR7 Putative uncharacterized protein10863e-116
A5BWP9 Putative uncharacterized protein10461e-111
C6TBD1 Putative uncharacterized protein10325e-110
Q3MQ10 Autophagy protein 5 (Fragment)9691e-102
Q3MQ05 Autophagy protein 5 (Fragment)8632e-090

Arabidopsis top hits (Blast detail)Scoree value
AT5G17290.1 APG5 (AUTOPHAGY 5); transporter15942e-177

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
104  33%
 
92  17%
 
122  17%
 
61  8%
 
81  8%
 
112  17%

Unigene MembersMember information