Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN05255

FASTA Sequence
Unigene ID: UN05255Length: 2312 SSRSNP
GGAATCTTTATGGGTCTAGGGGTGCACTCTCCTTCGCTGCTGCCGCGATGGCTGGGCTTGGAGCTGCTAGTGGTAGAGGTATCAGG
GGAAGTAGAGACATGCATGGGCGTACCCTGAATCGAAGTTCTGATGAGTCCTCTAAGTTGATGTTTACTGCGGGAGGAAAGCAACT
TAGTAGGCATATGACGATTTATCAGGCTGTGCAAAGACAACTTACGCTAGGCGAAGATGATGATGACAGGCTCGGTGGCAACGATT
TCATCTCGAGTGATGGAAGCAGATTAAGTGATATTTATACTATCATGTACCAGATGCCGGACAGCCAAGCGAATAGGTTGTCTGCT
GCTGGTGCAAGTTCAACCACACCATCTAAATCCACTAAATCTGCTACTACTAACGCAAGCGTAGAATCCCAGTCGTATAGGGCATC
TCTTTTGGATAGTATCGTACAAGGGAAGCTTCCATGCGACCTTGAGAAGTCAAATTCTACGTATAATGTCCTGGCGTTGTTGCGTG
TATTAGAAGGTTTAAATCAGCTTGGCCCTAGGTTAAGAGCCCAAACCGTTTCTGATCGTTTCGCAGAGGGTAAAATTACTAGTCTA
GATGATCCGAATACAACTGCTGCGAAGGTTTCTCATGAAGAATTCATCAACAGCAAACTTACACCAAAATTAGCTCGACAGATCCA
GGATGCGCTTGCTTTGTGCAGTGGAAGTCTTCCCTCTTGGTGCTACCAGTTGACTACAGCATGCCCGTTTTTGTTTCCGTTTCAGA
CCCGGAGACAGTATTTCTATTCAACCGCCTTTGGGTTGTCGCGTGCATTGAACCGCTTGCAGCAGCAGCAAGGTGCTGACGGCAGT
GGTTCTACGAACGAGCGAGAGATGAGGATAGGGAGATTGCAGCGCCAGAAAGTGCGTGTATCCCGAAATAGAATATTAGATTCTGC
TGCGAAAGTTATGGAGATGTATTCTAGCCAAAAAGCTGTGCTTGAAGTAGAATATTTTGGTGAAGTTGGTACTGGTCTAGGCCCCA
CACTTGAGTTTTACACACTCCTAAGCCATGATTTGCAAAAGGTTTCCCTTGGGATGTGGAGATCAAATGCTGGTGACAAGTTATCT
CTGCAGACTGATAGAGATGAGATTCAAGATGGGAAATCAGCAGCAGCTAGGGACAGAGATATAGTTCAGGCACCGCTTGGGTTGTT
TCCTCGGCCCTGGCCCTCAACAGCTGACGTATCCGAAGGTAGCCGGTTTCATAAAGTTGTTGAATATTTCCGCCTTTTAGGGCGCG
TGATGGCCAAAGCACTTCAAGATGGACGGCTAATGGACGTCCCGTTGAGTACAGCGTTTTATAAGCTTATTCTTGGTCAAGAGCTT
GATTTGCATGATATTATATTGTTTGATGCTGAACTTGGCAAGACTTTGCAAGAGCTTCGTGTTCTTGTTGGTCGTAAACACTATCT
GGAAGCAGAAGGTGGTGGCAACAGTAGCGCGATTTCTGATTTATGTTTACGTGGATCCCGTATTGAAGATCTTTGCTTGGACTTCA
CCCTACCTGGCTATCCTGAATGCATATTGAGACCTGGAGATGACATTGTTGATATTAATAGTCTTGAGGACTATATATCCTTGGTC
GTTGATGCTACTGTCAAGAGAGGAGTTGCCCGGCAGATCGAAGCCTTCAGATCTGGATTCAATCAGGTCTTTGACATAAAGTCTCT
ACAAATATTCACCCCTTCCGAGCTGGACTACTTGTTGTGTGGTCGTAGAGAGTTGTGGGAGGCGGAGACTCTTGTTGAACATATCA
AGTTTGATCACGGTTATACTGCAAAAAGTCCGGCAATCGTTAACTTACTGGAGATCATGGGAGAGCTTACAGCGGATCAACAGCGG
GCTTTCTGCCAGTTTGTAACTGGAGCTCCTAGGCTTCCTCCTGGTGGCTTAGCTGTTCTGAACCCGAAGCTGACGATTGTGAGAAA
GCTCTCATCAACCTCAAATGCAGCAGCTAATGGGACAGGGGCTACGGAAACAGCAGACGACGATCTTCCCAGCGTCATGACTTGCG
CCAACTACCTTAAGCTCCCTCCTTATTCTACTAAGGAAATCATGTACAAGAAACTGCTCTACGCCATCAACGAAGGGCAGGGATCG
TTCGACCTCTCATAGGCATATCTCTCTTGAGTCGGCGGTGGTGGCTATAAACCAAACCCCTCTCTCTCTCTCTCTCTTTGTACATT
ATACATCGGAAGTTTCTGATTCTGCACTTTGAATGTTATTTCTATTAAACCATGAGATTAAAATTAGTTTTCAATG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002868849 hypothetical protein ARALYDRAFT_912310 [Arabidopsis lyrata subsp. lyrata]33390.0
NP_849567 E3 ubiquitin-protein ligase UPL3 [Arabidopsis thaliana]32970.0
NP_195572 E3 ubiquitin-protein ligase UPL3 [Arabidopsis thaliana]32560.0
BAF01480 hypothetical protein [Arabidopsis thaliana]31770.0
XP_002530820 hect ubiquitin-protein ligase, putative [Ricinus communis]28350.0

Swiss-Prot top hits (Blast detail)Scoree value
Q6WWW4 E3 ubiquitin-protein ligase UPL332970.0
Q14669 Probable E3 ubiquitin-protein ligase TRIP1210003e-107
Q9LYZ7 E3 ubiquitin-protein ligase UPL48346e-088
Q10435 Probable ubiquitin fusion degradation protein C12B10.01c3453e-031
P33202 Ubiquitin fusion degradation protein 43444e-031

TrEMBL top hits (Blast detail)Scoree value
B3H700 Uncharacterized protein At4g38600.232560.0
B9SXV1 Hect ubiquitin-protein ligase, putative28350.0
Q6YU89 Putative HECT ubiquitin-protein ligase 325364e-284
C5YD96 Putative uncharacterized protein Sb06g00329025203e-282
A2WZR6 Putative uncharacterized protein25194e-282

Arabidopsis top hits (Blast detail)Scoree value
AT4G38600.1 KAK (KAKTUS); ubiquitin-protein ligase32980.0
AT4G38600.2 KAK (KAKTUS); ubiquitin-protein ligase32710.0
AT5G02880.1 UPL4; ubiquitin-protein ligase8345e-089
AT3G53090.1 UPL7; ubiquitin-protein ligase2127e-017
AT3G53090.2 UPL7; ubiquitin-protein ligase2127e-017

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
73  21%
 
112  14%
 
105  36%
 
182  14%
 
61  7%
 
91  7%

Unigene MembersMember information