Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN05973

FASTA Sequence
Unigene ID: UN05973Length: 1631  SNP
GGAAGTGGAGGGAGGCTGTCGAGGGAAAGAAGTGGACTAACGTGAGCGAGCTGGTGGAAGAGATGATGGGACTCGAGGTTTTGATC
AGAGGCCGTGTGCACACGAACCGTCCCATCTCTAACAAAAAGGGGTTTGTGATCTTGAGGCAGAGTGGATTCACGGTTCAGTGTGT
GGTTACTGAGTCGAAGGAGAATAATTTGAGTGTCAACATGGTCAAGTTCCTGAAGCAGCTGAGTGGCGAATCTTTTGTCGATGTCA
TTGGTATCGTCGTTATCCCCAAGGATTCTGTGACGGGAACCACGCAGCAGGTTGAGATTCAAGTGAGGAAAGTGTACTGCGTCAAC
AGTGCCTTGCAGAAGTTACCACTTATTGTCGAGGACGCTGCCCGGAGTGAAGCAGAGATTCAGGCTGGGAAACCTGGTGCTAATCA
GGATACGCGTTTGAACTATAGAGTGATCGACCTCAGGACACCAGCTAATCAAGCTATCTTCTGCATTCAGTGCCATGTCCAAATTG
CATTCAGGGAATTCTTACTATCTAAAGGGGTTTCTTGAAATCCACACACCGAAATTGATTGCTGGGAGTAGTGAAGGTGGTGCTGC
TGTGTTTAGGTTGGAGTACAAAGGGTAGCCTGCTTGTCTGGCTCAGTCTCCTCAGCTTCATAAGCAGATGGCAATATGTGGTGACT
TGGAACGCGTCTTTGAGGTTGGTGCTGTTTACAGAGCAGAAGACTCGTTCACTCATAGACATCTGTGTGAGTTTATTGGTCTTGAT
GTGGAGATGGCGATTCACAAGCACTATTCTGAGGTAATGGATATTGTGGGCGAGTTGTTTCCGTTCATATTCACTAAATTGGAAGA
GAGGTGCTCGAAGGAACTTGAAGCTATTAGAAAGCAATACCCATTTCAGCCATTGAAGTTTCTTCCAAAAACATTGATTCTACCCT
TTGCAGAAGGGATTCAAATGCTTAAGGAAGCTGGTGTCGAGGCTGATCCTCTTGGAGATTTAAATACAGAAGTTGAGAGAAAGCTT
GGCCAGCTCGTTCTGGAGAAGTACAACACAGAGTTCTACATCCTGCATCGCTATCCTTCGGCGATTAGGCCATTTTACACTATGCC
TTGTGCGGACGATCCTAACTACAGCAACTCATTCGATGTCTTTATAAGAGGTGAGGAGATCATATCAGGAGCTCAACGTGTCCATG
ACCCGGAACTTTTGAAGGAACAGGCAACACGAGTTGGCATTGACGTCGAGACAATAAAAACATACATTGATTCATTCAGGTACGGT
GCACCACCTCACGGTGGATTCGGAGTGGGTCTGGAGCGAGTGGTAATGCTCTTCTGTGGCCTCAACAACATCCGCAAAACATCGCT
CTTCCCTCGTGACCCTCTAAGACTCGCTCCCTAATATCTTTCCATCTCAAAGCTAAAGCGGTGGATCATTGCCGAACTCTGCTGAT
TTTTCTCATGAATACTTCTAAGAGTTTTAATGGCTGATATTTGTCTTTTCCTCTCATTCTTGCCCTTTCGAGCAAGTGAATCTTGT
TTTAGTTCTGTGATACTTGTGTTTCTGTCACATTACTTCTTTTTATCAAAGGCTTTGCATTACCTAAATAGATGTTCAAGAGC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002869341 hypothetical protein ARALYDRAFT_491623 [Arabidopsis lyrata subsp. lyrata]13071e-141
NP_194417 aspartyl-tRNA synthetase [Arabidopsis thaliana]12982e-140
AAL61938 aspartate--tRNA ligase - like protein [Arabidopsis thaliana]12811e-138
NP_849558 aspartyl-tRNA synthetase [Arabidopsis thaliana]12811e-138
XP_002868911 hypothetical protein ARALYDRAFT_490730 [Arabidopsis lyrata subsp. lyrata]12632e-136

Swiss-Prot top hits (Blast detail)Scoree value
P14868 Aspartyl-tRNA synthetase, cytoplasmic9187e-098
Q922B2 Aspartyl-tRNA synthetase, cytoplasmic9152e-097
P15178 Aspartyl-tRNA synthetase, cytoplasmic9142e-097
Q5R9I5 Aspartyl-tRNA synthetase, cytoplasmic9133e-097
Q3SYZ4 Aspartyl-tRNA synthetase, cytoplasmic9009e-096

TrEMBL top hits (Blast detail)Scoree value
Q8H104 Putative aspartate-tRNA ligase12981e-140
Q8VYA0 Aspartate--tRNA ligase-like protein12811e-138
Q9M084 AT4G31180 protein12811e-138
B9SBT1 Aspartyl-tRNA synthetase, putative12451e-134
B9HBL6 Predicted protein12291e-132

Arabidopsis top hits (Blast detail)Scoree value
AT4G26870.1 aspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative12994e-143
AT4G31180.1 aspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative12824e-141
AT4G31180.2 aspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative12824e-141
AT4G33760.1 tRNA synthetase class II (D, K and N) family protein1247e-007

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
91  7%
 
81  7%
 
74  29%
 
122  14%
 
191  7%
 
64  29%
 
151  7%

Unigene MembersMember information