Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN06344

FASTA Sequence
Unigene ID: UN06344Length: 1322 SSR 
GAAAGGCAGAAAAGCTAAGAAAATCTCAGTTTTGAACATTTCAAACACATAGAAAAAGAGAGAGAGAGAAGATCTGAAAGAAGAAT
GAGCAGCGAAGAAGAGAAGACGGTGTGTGTGACAGGAGCTTCAGGTTACATTGCTTCGTGGATCGTCAAGCTTCTCCTTCTCCGTG
GCTACACCGTTAAAGCCTCTGTTCGTGATCCAAATGATCCGAGGAAAACAGAGCATTTGCTTGCGTTAGAAGGTGCAGAGGAAAGG
CTTCAATTATTCAAAGCAAACTTGTTAGAAGAAGGCTCCTTCGACTCAGCAATCGACGGTTGCCAAGGAGTTTTCCACACTGCATC
ACCATTCTATCACGATGTCAAAGATCCTCAGGCTGAGTTACTTGATCCAGCAGTGAAAGGAACAATTAATGTTCTAAGCACTTGCT
TGAAGACTCCCTCTGTTAAGAGAGTCGTCTTAACCTCATCTATAGCAGCTGTTGCTTTCAATGGAATGCCTCGAACACCCGATACC
ATAGTTGATGAAACTTGGTTCGCCGATCCTGAATATTGCAGAGCTGCCAAGCTATGGTATGTACTCTCCAAGACATTAGCTGAAAA
TGCAGCGTGGAAGTTCGCGAAAGAGAACGATATGCAGCTGGTTTCGATAAATGCAGCAATGGTGATTGGTCCTCTTTTACAGCCAA
CGCTCAACACTAGTGCTGCTGCAGTACTAAGCTTGATCAAAGGAGCACAGACGTTTCCTAATGCGACATTCGGGTGGGTTAACGTC
AAAGATGTAGCAAACGCTCATATTCAAGCGTTTGAGAATCCAGAAGCTAATGGAAGATACTGTTTAGTGGAGAGAGTTGCTCATTA
CTCTGAGGTTGTTAACATTTTGCATGATCTTTACCCTGATTTTCAACTCCCTGAGAAGTGTGCAGATGAAAAGATATTTATTCCAA
CCTACAAAGTGTCAAAAGAGAAAGCAGAGTCTCTTGGGGTTGAGTTTGTGCCATTGGAGGTTAGCATAAAGGAGACTGTTGAGAGT
TTGCAAGACAAAGGGTTCATCAGATTTTGAGTTTCATGCCAGAACCAGACTTGGATGTGTTTGTGTTTCCTTCCTTCCCATGTTTC
TACTTTTTAATTTGGTTGTGGTTATTTTCCTTAATTTAATTCTGGAGTGCATGTGTTGCCTATGACATTTTGAAAGTTTGTTTTTG
CAGAATTAAACTATTTTGTTCTCATTGGAATTTGTATTTGCATGTAATTTGGTGTATAATTATTTCCTAATAAGTAATGAGTCTAT
ATGTCAACAAGTGATATTTGCCTCATTTTACC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_175552 Rossmann-fold NAD(P)-binding domain-containing protein [Arabidopsis thaliana]16205e-178
AAG52618 cinnamyl alcohol dehydrogenase, putative; 82967-79323 [Arabidopsis thaliana]16143e-177
XP_002891638 hypothetical protein ARALYDRAFT_314503 [Arabidopsis lyrata subsp. lyrata]16116e-177
XP_002314079 cinnamoyl CoA reductase-like protein [Populus trichocarpa]14162e-154
AAC06319 putative cinnamyl alcohol dehydrogenase [Malus x domestica]13948e-152

Swiss-Prot top hits (Blast detail)Scoree value
P51103 Dihydroflavonol-4-reductase6069e-062
Q9XES5 Bifunctional dihydroflavonol 4-reductase/flavanone 4-reductase5942e-060
P51104 Dihydroflavonol-4-reductase5924e-060
Q84KP0 Bifunctional dihydroflavonol 4-reductase/flavanone 4-reductase5871e-059
P51110 Dihydroflavonol-4-reductase5843e-059

TrEMBL top hits (Blast detail)Scoree value
Q4PSZ5 Putative cinnamyl-alcohol dehydrogenase16204e-178
Q9C8J3 Cinnamyl alcohol dehydrogenase, putative; 82967-7932316142e-177
B9HNY0 Cinnamoyl CoA reductase-like protein14162e-154
O65152 Putative cinnamyl alcohol dehydrogenase13946e-152
Q2Z1Z0 Cinnamyl alcohol dehydrogenase13741e-149

Arabidopsis top hits (Blast detail)Scoree value
AT1G51410.1 cinnamyl-alcohol dehydrogenase, putative (CAD)16211e-180
AT5G19440.1 cinnamyl-alcohol dehydrogenase, putative (CAD)13219e-146
AT1G09510.1 cinnamyl-alcohol dehydrogenase family / CAD family9266e-100
AT1G09480.1 cinnamyl-alcohol dehydrogenase family / CAD family9168e-099
AT1G09490.1 cinnamyl-alcohol dehydrogenase family / CAD family8952e-096

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
122  17%
 
85  42%
 
71  8%
 
91  8%
 
102  17%
 
61  8%

Unigene MembersMember information