Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN07294

FASTA Sequence
Unigene ID: UN07294Length: 450 SSR 
GGAAACCAAAAAAGGAAGACAAATAAATAAATAAAAAGTCATCAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAGCCATG
GACGCCATCGATTCCGTCGTTGATCCTCTCAGAGACTTTGCAAAGGACAGCATTCGTCTCGTTAAGCGTTGTCACAAACCAGATCG
CAAAGAATTCACGAAAGTGGCGGTCCGTACAGCGATCGGGTTTGTAGTAATGGGATTCGTGGGATTCTTCGTGAAGCTCATTTTTA
TTCCCATCAACAACATCATCGTCGGTGCCACCTAGATAACCAGCGAAGAAGAAGAATAAGAAGGGTAGAAACAGCTTTCTTGTTTC
AAGAAAACAATTTCACAGTTTTTTTTTGTTCAGATACTCAGAAAGAGGAAACATATGTTAACCAACACATTTGAGATCAGTTTCCA
GTAATTGCATTCTATTTTAT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_194222 protein transport protein sec61 subunit gamma-1 [Arabidopsis thaliana]3491e-031
NP_001148682 protein transport protein SEC61 gamma subunit [Zea mays]3364e-030
NP_001147308 protein transport protein SEC61 gamma subunit [Zea mays]3355e-030
XP_002318732 predicted protein [Populus trichocarpa]3321e-029
XP_002451650 hypothetical protein SORBIDRAFT_04g005280 [Sorghum bicolor]3321e-029

Swiss-Prot top hits (Blast detail)Scoree value
Q9SW34 Protein transport protein Sec61 subunit gamma-13498e-033
P38385 Protein transport protein Sec61 subunit gamma3319e-031
Q9SMP2 Protein transport protein Sec61 subunit gamma-33211e-029
Q7Z1B8 Protein transport protein Sec61 subunit gamma2637e-023
Q8I7D9 Protein transport protein Sec61 subunit gamma2592e-022

TrEMBL top hits (Blast detail)Scoree value
B6SPI4 Protein transport protein SEC61 gamma subunit3362e-030
C5Z769 Putative uncharacterized protein Sb10g0260003362e-030
B6SPB6 Protein transport protein SEC61 gamma subunit3353e-030
A9P9P6 Predicted protein3327e-030
B6TB44 Protein transport protein SEC61 gamma subunit3327e-030

Arabidopsis top hits (Blast detail)Scoree value
AT4G24920.1 protein transport protein SEC61 gamma subunit, putative3506e-034
AT5G50460.1 protein transport protein SEC61 gamma subunit, putative3506e-034
AT3G48570.1 protein transport protein SEC61 gamma subunit, putative3221e-030

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
96  86%
 
201  14%

Unigene MembersMember information