|
Information for unigene UN07294
FASTA Sequence |
Unigene ID: UN07294 | Length: 450 |
SSR | | GGAAACCAAAAAAGGAAGACAAATAAATAAATAAAAAGTCATCAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAGCCATG
GACGCCATCGATTCCGTCGTTGATCCTCTCAGAGACTTTGCAAAGGACAGCATTCGTCTCGTTAAGCGTTGTCACAAACCAGATCG
CAAAGAATTCACGAAAGTGGCGGTCCGTACAGCGATCGGGTTTGTAGTAATGGGATTCGTGGGATTCTTCGTGAAGCTCATTTTTA
TTCCCATCAACAACATCATCGTCGGTGCCACCTAGATAACCAGCGAAGAAGAAGAATAAGAAGGGTAGAAACAGCTTTCTTGTTTC
AAGAAAACAATTTCACAGTTTTTTTTTGTTCAGATACTCAGAAAGAGGAAACATATGTTAACCAACACATTTGAGATCAGTTTCCA
GTAATTGCATTCTATTTTAT
|
|
|
GenBank top hits (Blast detail) | Score | e value |
NP_194222 protein transport protein sec61 subunit gamma-1 [Arabidopsis thaliana] | 349 | 1e-031 |
NP_001148682 protein transport protein SEC61 gamma subunit [Zea mays] | 336 | 4e-030 |
NP_001147308 protein transport protein SEC61 gamma subunit [Zea mays] | 335 | 5e-030 |
XP_002318732 predicted protein [Populus trichocarpa] | 332 | 1e-029 |
XP_002451650 hypothetical protein SORBIDRAFT_04g005280 [Sorghum bicolor] | 332 | 1e-029 |
Swiss-Prot top hits (Blast detail) | Score | e value |
Q9SW34 Protein transport protein Sec61 subunit gamma-1 | 349 | 8e-033 |
P38385 Protein transport protein Sec61 subunit gamma | 331 | 9e-031 |
Q9SMP2 Protein transport protein Sec61 subunit gamma-3 | 321 | 1e-029 |
Q7Z1B8 Protein transport protein Sec61 subunit gamma | 263 | 7e-023 |
Q8I7D9 Protein transport protein Sec61 subunit gamma | 259 | 2e-022 |
TrEMBL top hits (Blast detail) | Score | e value |
B6SPI4 Protein transport protein SEC61 gamma subunit | 336 | 2e-030 |
C5Z769 Putative uncharacterized protein Sb10g026000 | 336 | 2e-030 |
B6SPB6 Protein transport protein SEC61 gamma subunit | 335 | 3e-030 |
A9P9P6 Predicted protein | 332 | 7e-030 |
B6TB44 Protein transport protein SEC61 gamma subunit | 332 | 7e-030 |
Arabidopsis top hits (Blast detail) | Score | e value |
AT4G24920.1 protein transport protein SEC61 gamma subunit, putative | 350 | 6e-034 |
AT5G50460.1 protein transport protein SEC61 gamma subunit, putative | 350 | 6e-034 |
AT3G48570.1 protein transport protein SEC61 gamma subunit, putative | 322 | 1e-030 |
EST library breakdown for ESTs in the assembly |
Library |
ESTs | Percentage of ESTs in assembly |
|
|
|
|