 |
Information for unigene UN07298
| FASTA Sequence |
| Unigene ID: UN07298 | Length: 559 |
SSR | | ACTTTCAACAAATATTATTTCTATTTACAACGTAGACAAAATACACACTGATTCTCTATTGTAACCCCTTTCCACATACACTACAA
AGATAAACAAATGTTGTTACTCCTCTTCAATTAATTGGCTGCAGAGTTGTTGTTGTTGTTGCCTCAGATTCAATTGACTTGGTGAA
CTGCAGAAACAACCACACAAATAAATAAAACAAGTGTTTTTAGAAACAAACGTAGCGCAATGTTAAGTTACATTTCTGTTAACAAC
TCGAACCTGAGATATCTTTAGATCAAGCTCATTCCACTCTGAGGTTGGGTTGCTTCCTGCTACTATCCCTGTCCCCGCATAGATCA
ATGCCCCAAGACCCTTCTCCACTAGAGCTGATCTGATACCAACTGCAAACTCACTCTCCTCTCCACCAAAGAAACCAATAGGTCCA
GCGTACATTCCTCTATCAAATGATTCTATTTCCTTAATCAAAAGCCTAGCTTCTTCTGCTGGAAGCCCACAAACAGCTGGAGTTGG
ATGCAGAGCAGCCAAGATATCAAACTCGTCATCTTCCCTCCTC
|
|
|
| GenBank top hits (Blast detail) | Score | e value |
|---|
| NP_974143 Isochorismate synthase 1 [Arabidopsis thaliana] | 561 | 6e-056 |
| BAJ33994 unnamed protein product [Thellungiella halophila] | 496 | 2e-048 |
| XP_002887554 hypothetical protein ARALYDRAFT_476608 [Arabidopsis lyrata subsp. lyrata] | 476 | 5e-046 |
| NP_565090 Isochorismate synthase 1 [Arabidopsis thaliana] | 475 | 6e-046 |
| AAC97926 isochorismate synthase [Arabidopsis thaliana] | 475 | 6e-046 |
| Swiss-Prot top hits (Blast detail) | Score | e value |
|---|
| Q9S7H8 Isochorismate synthase 1, chloroplastic | 475 | 3e-047 |
| Q9M9V6 Isochorismate synthase 2, chloroplastic | 457 | 4e-045 |
| Q9ZPC0 Isochorismate synthase, chloroplastic | 361 | 5e-034 |
| P44613 Menaquinone-specific isochorismate synthase | 234 | 3e-019 |
| P23973 Menaquinone-specific isochorismate synthase | 207 | 4e-016 |
| TrEMBL top hits (Blast detail) | Score | e value |
|---|
| B9R951 Isochorismate synthase, putative | 416 | 3e-039 |
| A5AIP0 Putative uncharacterized protein | 413 | 7e-039 |
| B9I302 Isochorismate synthase | 412 | 9e-039 |
| D1GI62 Isochorismate synthase | 412 | 9e-039 |
| D1KKB1 Isochorismate synthase | 412 | 9e-039 |
| Arabidopsis top hits (Blast detail) | Score | e value |
|---|
| AT1G74710.2 isochorismate synthase 1 (ICS1) / isochorismate mutase | 561 | 3e-058 |
| AT1G74710.1 isochorismate synthase 1 (ICS1) / isochorismate mutase | 475 | 3e-048 |
| AT1G18870.1 ICS2 (ISOCHORISMATE SYNTHASE 2); isochorismate synthase | 457 | 4e-046 |
| AT1G18870.2 ICS2 (ISOCHORISMATE SYNTHASE 2); isochorismate synthase | 457 | 4e-046 |
| EST library breakdown for ESTs in the assembly |
| Library |
ESTs | Percentage of ESTs in assembly |
|
|
|
|
