Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN07842

FASTA Sequence
Unigene ID: UN07842Length: 774 SSR 
CCTCCGTTTTCCACTCACTCTCTCTCTCTCTCTCTGTCTCTCGCAGTCGTCTCGAGATGGCTTCAGCTACTTCCGTCATAGCTTGG
GGCTCAGGAGAAGATGGGCAACTAGGACTTGGAACATACGAAGAAAAGGAATGGGCTTGCGTTGTCGAGGCTCTGGATCCTTTTAC
CGTTCGCTCCGTCGTCGGTGGTAGCCGCAACTCCCTCGCCATTTGCGATGATGGCAAGCTGTTTACATGGGGTTGGAATCAAAGGG
GTACATTAGGACACCCACCAGAGAAGAAAACAGAAAGCATCCCTAGTCTTGTTAAGTCTCTCGCCAATGTCAAGATTACTCAGGCT
GCTATTGGTGGTTGGCATTGTTTAGCTGTCGATGATCAAGGCCGAGCATATGCTTGGGGAGGAAACGAATATGGGCAGTGTGGTGA
AGAGCCTTCCAAAGATGAGACAGGTAGGCCTGTGCGTAGAGATATTGTAATCCCTAAGCGTTGTGCCCCTAAACTTACTGTCCGTC
AGGTAGCTGCAGGGGGTACTCACTCTGTGGTTCTAACCCGTGAAGGTTCTGTATGGACTTGGGGTCAACCTTGGCCTCCCGGTGAC
ATAAAACAGATATCTGTGCCTGTAAGAGTTCAGGGTCTTGAAAACGTTCGTCTGATTGCTGTTGGAGCTTTTCATAACTTGGCTCT
CAAAGAGATGGGACTCTGTGGGCTTGGGGTAATAATGATATGGACACTTGGACCGGAGATACCCAACCTAGATCTCATCTATTCTG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002873752 regulator of chromosome condensation family protein [Arabidopsis lyrata subsp. lyrata]10772e-115
NP_197108 regulator of chromosome condensation repeat-containing protein [Arabidopsis thaliana]10728e-115
AAM61698 UVB-resistance protein-like [Arabidopsis thaliana]10664e-114
NP_186900 regulator of chromosome condensation domain-containing protein [Arabidopsis thaliana]10602e-113
NP_001030623 regulator of chromosome condensation domain-containing protein [Arabidopsis thaliana]10602e-113

Swiss-Prot top hits (Blast detail)Scoree value
Q9VR91 Probable E3 ubiquitin-protein ligase HERC22865e-025
Q15751 Probable E3 ubiquitin-protein ligase HERC12418e-020
Q15034 Probable E3 ubiquitin-protein ligase HERC32283e-018
Q9UII4 Probable E3 ubiquitin-protein ligase HERC52231e-017
O95714 E3 ubiquitin-protein ligase HERC22158e-017

TrEMBL top hits (Blast detail)Scoree value
Q9LFS0 At5g1604010725e-115
Q8LEY9 UVB-resistance protein-like10663e-114
Q2V3Z2 Putative uncharacterized protein At3g0251010601e-113
Q1KUV8 Putative uncharacterized protein10403e-111
B9N218 Predicted protein10091e-107

Arabidopsis top hits (Blast detail)Scoree value
AT5G16040.1 regulator of chromosome condensation (RCC1) family protein10723e-117
AT3G02510.1 regulator of chromosome condensation (RCC1) family protein10608e-116
AT3G02510.2 regulator of chromosome condensation (RCC1) family protein10608e-116
AT5G63860.1 UVR8 (UVB-RESISTANCE 8); chromatin binding / guanyl-nucleotide exchange factor2741e-024
AT5G08710.1 regulator of chromosome condensation (RCC1) family protein / UVB-resistance protein-related1915e-015

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
61  33%
 
81  33%
 
111  33%

Unigene MembersMember information