Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN08245

FASTA Sequence
Unigene ID: UN08245Length: 765  SNP
GGGCCTCCGAATTCAATCAATCAGAAAAAGTAAATCGTTTTCGATCTGAGAGAAAAGAGAGAAAGCGTCGTGCGAAGAAGAATCAA
AAAGAGATGGATGGATTGAAGGGATTCTGGGCGGAGAAGTTATCATTCCTGGAGAATTACACGAGGTTCACCAAACGTGACACGCC
TCTTCCTTCTTGGTCTTCCTCCGACGTCGATGAGTTCATTGCCTCCGATCCCGTCAATGGACCCACCCTGAAAACAGCTAGGGAAG
CTGCGACTTTCGGTGCTACTGGAGCCGCACTTGGAGCTGTGTCCACTGCTGCTTTTGCTTGGAAATACTCCAGGAGTCCACATGGT
ACTGCACTGTCCTTCTTAGGAGGAGGTCTTTTTGGTTGGACCTTTGGGCAAGAAGTAGCCAACCACACGATGCAATTGTATAAGCT
GGACACAATGGCGGCTCAAGTTAAGTTCATGGAATGGTGGGAACGCAAGTCTCAGGGAAGGTCCTGAACCCAAAAAAAAAAACAGA
GAGACGGGTGCTACTTTCTCGCCCAAGCTTGTCTTGCAAACAACGTGAGATGGTGGCAGCAGTTAAATCCATTTTCAGTCTCTCTT
TCGAACCTTTCTTTATGTTCTCACTCTCGAAACATGTTTGTTTTCCATGTCTCAATAATTCAACAAGCTCCATGGAGAATGCTGAG
TAGATGAATCGAAACAAACTAAATGGTCTCATTTGGATTTTTATAATAAGAAGTTTATTCAGTGTTAAATACGAAAA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_563819 uncharacterized protein [Arabidopsis thaliana]6417e-065
XP_002889697 hypothetical protein ARALYDRAFT_888081 [Arabidopsis lyrata subsp. lyrata]6391e-064
XP_002515864 conserved hypothetical protein [Ricinus communis]5451e-053
ACU13938 unknown [Glycine max]5225e-051
ACU18633 unknown [Glycine max]5162e-050

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q941A6 At1g08480/T27G7_106415e-065
B9RQ45 Putative uncharacterized protein5457e-054
C6SXG5 Putative uncharacterized protein5223e-051
C6T9Y1 Putative uncharacterized protein5162e-050
A9P8C2 Predicted protein5116e-050

Arabidopsis top hits (Blast detail)Scoree value
AT1G08480.1 unknown protein6413e-067

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
104  29%
 
115  36%
 
122  14%
 
181  7%
 
191  7%
 
61  7%

Unigene MembersMember information