Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN08252

FASTA Sequence
Unigene ID: UN08252Length: 975  SNP
ACTTCGCTCCTCGTCTCTCCTCCTCCATTATCGTTGCTCGATCCGTAACATCAAAGATTGATTAAGGTGCAATGGGAGACAGTCAG
TACTCGTTTTCACTCACTACCTTCAGCCCTTCAGGGAAGCTGGTTCAGATAGAGCATGCTCTAACTGCCGTTGGATCAGGCCAGAC
ATCTTTGGGAATCAAAGCTTCGAACGGAGTTGTTATTGCTACTGAAAAGAAGCTTCCCTCTATTCTTGTTGATGAAGCCTCTGTTC
AAAAGATTCAGCATTTGACTCCCAACATTGGAGTTGTATACAGTGGTATGGGTCCTGATTTCCGAGTTCTTGTGCGAAAGAGTAGG
AAGCAGGCTGAGCAATACCTCCGCTTGTACAAAGAACCTATCCCTGTCACTCAACTTGTGAGGGAAACTGCTACGGTCATGCAAGA
GTTCACTCAATCAGGTGGTGTGAGGCCGTTTGGAGTTTCTCTTCTAGTGGCTGGGTATGATGACAAGGGCCCACAGCTGTACCAGG
TGGATCCGTCTGGTTCTTATTTCTCATGGAAAGCTTCGGCGATGGGAAAGAATGTTTCGAATGCCAAGACATTTCTCGAGAAGAGG
TACACAGAAGATATGGAGCTTGATGATGCGATTCATACGGCTATATTGACACTGAAGGAAGGTTTTGAGGGAGAAATCTCGAGCAA
GAACATCGAGATTGGCAAGATTGGTGCTGACAAAGTCTTTAGGGTACTAACACCGGCAGAGATCGACGATTACTTGGCTGAGGTCG
AGTAAAAACTTTCACTTTGGCCGCCCAACAAACCTCGAGTTGAATCTCATTACTATCTTTTACTTTTCTGCCTAGTTGGTAAAAAG
ACTGATGGTTCTTGCGTTTGTAAAACTATTCCAACTTGTTAACACTCGAGACCTTGTTTAGTTTTCATTCGTTTAGACAATGTTCA
AATCCACAATCAGAAGTCATGCACACAAT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_173096 proteasome subunit alpha type-2-A [Arabidopsis thaliana]11822e-127
XP_002889236 hypothetical protein ARALYDRAFT_895825 [Arabidopsis lyrata subsp. lyrata]11786e-127
XP_002890168 hypothetical protein ARALYDRAFT_471845 [Arabidopsis lyrata subsp. lyrata]11786e-127
NP_178042 proteasome subunit alpha type-2-B [Arabidopsis thaliana]11742e-126
XP_002513374 proteasome subunit alpha type, putative [Ricinus communis]11321e-121

Swiss-Prot top hits (Blast detail)Scoree value
O23708 Proteasome subunit alpha type-2-A11829e-129
Q8L4A7 Proteasome subunit alpha type-2-B11748e-128
A2YVR7 Proteasome subunit alpha type-210743e-116
Q10KF0 Proteasome subunit alpha type-210743e-116
Q54DM7 Proteasome subunit alpha type-28234e-087

TrEMBL top hits (Blast detail)Scoree value
B9RI05 Proteasome subunit alpha type11329e-122
A9PAG0 Proteasome subunit alpha type11256e-121
C6TH59 Proteasome subunit alpha type11175e-120
Q38M52 Proteasome subunit alpha type11051e-118
C6TKI4 Proteasome subunit alpha type11042e-118

Arabidopsis top hits (Blast detail)Scoree value
AT1G16470.1 PAB1 (PROTEASOME SUBUNIT PAB1); endopeptidase/ peptidase/ threonine-type endopeptidase11836e-130
AT1G16470.2 PAB1 (PROTEASOME SUBUNIT PAB1); endopeptidase/ peptidase/ threonine-type endopeptidase11836e-130
AT1G79210.1 20S proteasome alpha subunit B, putative11755e-129
AT1G79210.2 20S proteasome alpha subunit B, putative11755e-129
AT1G79210.3 20S proteasome alpha subunit B, putative11755e-129

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
102  18%
 
114  36%
 
122  18%
 
191  9%
 
201  9%
 
61  9%

Unigene MembersMember information