Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN08398

FASTA Sequence
Unigene ID: UN08398Length: 1572  SNP
ATCTTAAGTTTTTGGATTTTTTTAAAGCCACTGATCATTCGATAAAACGAAACATAAATAAGAAACTGATATTTTTAAGGGGTAGA
CATTAAGCTTAAACATTTAGCTTCTCAATCTCTCTCCTTAGAGCATTAGCTCTAAACACACTCCCAATGGTGTTCACAGCCAACTT
CAAATCCTCCAAAGGACTACCCGGTGCGACCCTCTTGTACAGATAGCTATCAAACGTCATCTTCTGAACGTACTCATCTCCACACA
TCTCCACAAACGCTTCTCTAGCCGGATTGGATCTGTAAAACACTTTCTGCAACACATCAAGCACCCTGTACGTAGGCAAGTACGTC
TTGTCCCATTTCTCCAAGTACTTCCTCAAATCACTTTCATCAATCATCTTCTTACCGTTCTGTGAACCTTCAACGATGGCTTCAGC
ACACATCCTTCCACTCTTTGCAGCGAAGTAGATCCCTTCGCCGGAGCATTTAGTCACGTACCCTGCAGCATCACCAACAAGAGCCA
CACGCTTGGAGAGCCTGCGCGGTCTCGGGTGTTCAGGAATAGGGTGAGCCTCCACGCGGATGATCTTGCCTCCTAGAATCTTGTCC
TTGGCTCTGTTTCTTGTCGCGAGCTGGAACTTCTTGATGTCACCTTTGTGCGTAACAGTGCCTGTCCCGACAGCCACGTGGTCGCA
TTTAGGGAACACCCATCCGTAAAAGTCCGGCGACACGTCATCACCGACGTACATCTCAGCTAGATCCTCGTAGTACGTCATCTTAT
CATCTGGGATTCTGATTCTCTCCTGAAAAGCGATGGCATAGTCGTAATCTCCAGCACCGATAGACTTGGCAACTCTAGAGTTAGCT
CCGTCAGCTCCGATAACGGCGTCAACCTCCATCGTCTTCTTCTGTCCCGTAGCTCCCGTCTTCCCATCATACTCCGTGTAATGCAA
CACGTACGGCGAGTCCCACTCCTCGGGAAGATCCATCTTGAGAAAGAGACCGTTGATAACAGTAGCTCCACTCTTCTCCGCTCTCT
CCCTCAGGTACTGGTCAAGAACCTCCCTCCTCACCATCCCTATGTACTCGTGCTCCTTGAGCGTGCGGCCGATGTCGACGGCGATG
TTGGACGGAGAGATCATCTTCATCTTCGTCACCCTCCTGTCGATGATGTCCAGCGGCAGGTTGAACTCTCCGACCATGCAGAGAGG
GATCGCGCCGCCGCAGGGCTTGCAGTTGTCCATCTTCCGCTCGATGAGGATCGTCTCGACGCCTCCCTGGGCGAGAGTCTCGGCGG
CGGCTCCTCCCGCCGGGCCTCCGCCGATGACGGCGACGCGGAGGGTGCGGTTGGCGAGCTTGGGGCTGGCTCTTGACGCGGTTACT
CTGAGGGAGGTCCGTCGATGGGGGAGAGAGAGTGAGGATGGAACATGGGAGACGAGAGTTATCTGGTCCGTTGGGGACTGGCGAAG
TCCGGTGAAGGATTTGAGTGCAAACGACGACATTGTTGTTGTACTACAGTGAAGAACACTGAACAGGAGATGGAGTGTGTGTTGTG
CTGTGTCTTCTCTCTCCTCAAGTT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
ABI63587 geranylgeranyl reductase [Brassica rapa subsp. pekinensis]23653e-264
CAA74372 geranylgeranyl reductase [Arabidopsis thaliana]22821e-254
NP_177587 geranylgeranyl diphosphate reductase [Arabidopsis thaliana]22741e-253
XP_002887543 hypothetical protein ARALYDRAFT_476582 [Arabidopsis lyrata subsp. lyrata]22731e-253
AAN31803 putative geranylgeranyl reductase [Arabidopsis thaliana]22694e-253

Swiss-Prot top hits (Blast detail)Scoree value
Q9CA67 Geranylgeranyl diphosphate reductase, chloroplastic22744e-255
Q9ZS34 Geranylgeranyl diphosphate reductase, chloroplastic19752e-220
Q6Z2T6 Geranylgeranyl diphosphate reductase, chloroplastic17646e-196
Q55087 Geranylgeranyl diphosphate reductase14204e-156
P26172 Geranylgeranyl diphosphate reductase3684e-034

TrEMBL top hits (Blast detail)Scoree value
Q09JZ1 Geranylgeranyl reductase23652e-264
A9PH25 Predicted protein20344e-226
B7X936 Geranylgeranyl reductase20238e-225
B9RLY0 Geranylgeranyl hydrogenase, putative20221e-224
C8CLK4 Geranyl geranyl reductase20022e-222

Arabidopsis top hits (Blast detail)Scoree value
AT1G74470.1 geranylgeranyl reductase22753e-256

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
195  42%
 
121  8%
 
82  17%
 
71  8%
 
111  8%
 
101  8%
 
181  8%

Unigene MembersMember information