Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN08565

FASTA Sequence
Unigene ID: UN08565Length: 2214 SSRSNP
CCGGGCTCCTTTGGACAGCAGTACGGCGGATTGGGCCGTGGAACCGTCGGAATGTCGGAAGCGGGTTCGAATCCAAGTGTCCCCCC
GCAGGGTAGGATGATGCAAGGCACTTAGGGAATGATGGGGACGATTGGGTCAGGCTCTCAAATGCGGCCAAGTGGAATAATGCCTC
AGCACCAGCAGAGACCGGGTCAAGCCTCTCTAAGACCAGCTTCCTCTCCGAGTAGTCCATCTCCTGTTCCTCAAAACTTTCAAGCG
CATGGCCTTATGAGACCTTCATCTATTGGTTCTCCTGGTGTCCAATCTACTGGTGCAGCACAGCACAGCTTGCAAGCCACTAATCA
ACCATGGTTATCATCTTCTGCCCAAGGGAAGCCGCCTTTGGCACCTCCTTCTTATAGACCGCAAGTAAATAATAATCCCTCCTCCA
TGCAACAAAGATCGCACGTTACTCAGCAGCATCTTTCCACGTCACCAGCGACTTCACAGCCTCAGCAACAGCAACAACAACAACAA
CATCAGCTTCAGCCTCAAGAGCAACATCAACAATTGAGACCTCCGCATCAGACTTTACCTTACTCACATCAACCGGCCCGGGTCCA
AGGGTTGGTAAATCAGAAAGCTGCTTCTCCAGCAATGCCGAGCCCGCCCCCTGTGCCTCAACCAGGAAGCCAAGCTAAGCCAGTTT
CAGTAGAGAATGAGGAGTCTGATGATCGTATCCTGGGGAAAAGAAGCATCCATGAGCTACTTCAACAGATTGATCCGTCAGAGAAA
TTGGATCCAGAGGTTGAAGGCATCCTTGCTGATATTGCTGAAGACTTTGTGGAGTCAATCACAACTTTTGGATGTTCTTTAGCCAA
GCATAGAAAGTTTGATACTCTAGAGGCCAAAGACATCTTGCTCCATGTTGAAAGAAACTGGAATATCAGGCCTCCTGGTTTTAGCA
GTGACGAGATCAAGACATTTCGAAAGCCACTGGCAACAGATATTCACAAAGAGAGACTTGCCGCTGTAAAGAAGTCTGTGACGGTA
ACGGAAGCATCAAACGCCAGGAATCCGTTTGGGCATGGAACAGCTAATGCAAGAGGAGGAGGCCAGGCAAAGACGCCTGCTAATCC
CTTGGCCTCTACAACTTTTAATCACTGATTGTATTAGATTTAACCCTTCAGTCTTGTTTGATAGGAAATTTTCCATTTAAAAGGTT
AAGAACTTCTGTAAAAAGGTTCCAGCCTAGATTTTATATTCGAACCATAAGTAAAGTATCTTATCGGCTTATGGGATTGAACCGAG
TCTGATGTTTTTGCAAAGCACAACAAACATGTACTAATAGAAGAACAAGAGATGAGAAGTGGGTATGAATCCAGACTAGCCGGTAT
CATTAAACAGATTCTTCTGATACAGATGAAGCTTCCATAGCTCTGGATCCATTTCTCGCTTCTTATTAGTATCTTAGCCTTCAACG
ATCTTCACTGGCGTCCCGAAAGGACTCTGCTTGATTGATAAGAGCTCAATGTCAAGCTCGATTGTTGCGTTAGGAGGAATCTCTTG
CACTCCTTTCTTTCCGTAAGCAAGCTCCGGAGGAACAATCACCAGTCTCTGACCGCCTACATGCATCCCTTCAACGCCAAGGTCGA
GTCCTTTGAGAACATTCCCGTTCTCTGATTGTCCAATGTCAAACCCGTAAGGCGTTCCACCTCCAACGCCAAGTCCTTGTCGACTT
GTCATGAACGTTATCCCTTTCCATTTTGCAACATAGTGGACTGCGACCCGAGATCCTTTCACAGCCTCTGCTCCATTGCCAACTTT
TATATCATAGTACTTGAGACCATTGGGGAGAGTAGTAAACTCGCTGTCAGGTATCTTAGATGCACGTAGAGCTCTTCTACTGGTGC
TTACGGCCTCGGATGAATCAGTTAACAGAATCCCAGACGCAGCGGAGAGGAGACATCCAAGTAAAACTCTTCTTCCTTCGTAGCTC
ACCGGTGGCGCCGGAGAAACAACGGTCTCTGGTCTGATGATCTTTTCGCCGCCGGGAGACGGTAACGAGCACCGGTAAGATTTGGA
TTGCCTTCTTCTTGATTGAAAAGGAATGGAGGAAGAGAGAGAATGATGGAGAGGATGAAGAAGTTTCATTGGTAAGATCATTGTTG
TGTCTGATGAGTGAAAGAAGCTTGCTTCTTCTTCTTCTGAGTTTGAGCTTCAGTTGTGTTGTCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002884775 tata-associated factor II 58 [Arabidopsis lyrata subsp. lyrata]15617e-171
NP_566367 transcription initiation factor TFIID subunit D10 [Arabidopsis thaliana]15251e-166
NP_187617 FKBP-like peptidyl-prolyl cis-trans isomerase-like protein [Arabidopsis thaliana]10527e-112
XP_002882651 hypothetical protein ARALYDRAFT_897182 [Arabidopsis lyrata subsp. lyrata]10455e-111
XP_002277150 PREDICTED: hypothetical protein [Vitis vinifera]10106e-107

Swiss-Prot top hits (Blast detail)Scoree value
Q555L9 Transcription initiation factor TFIID subunit 123274e-029
O13722 Transcription initiation factor TFIID subunit 123077e-027
Q03761 Transcription initiation factor TFIID subunit 122621e-021
P49905 Transcription initiation factor TFIID subunit 122243e-017
P0C1B0 FK506-binding protein 41714e-011

TrEMBL top hits (Blast detail)Scoree value
Q9SR71 Putative TBP-associated 58 kDa subunit protein15257e-167
Q9SR70 AT3g10060/T22K18_1110525e-112
B9HBK0 Predicted protein7882e-081
B9SRU6 Putative uncharacterized protein7811e-080
C6SWU7 Putative uncharacterized protein7651e-078

Arabidopsis top hits (Blast detail)Scoree value
AT3G10070.1 TAF12 (TBP-ASSOCIATED FACTOR 12); DNA binding / transcription initiation factor15263e-169
AT3G10060.1 immunophilin, putative / FKBP-type peptidyl-prolyl cis-trans isomerase, putative10585e-115
AT1G17440.1 EER4 (ENHANCED ETHYLENE RESPONSE 4); DNA binding / transcription initiation factor3873e-037
AT1G17440.2 EER4 (ENHANCED ETHYLENE RESPONSE 4); DNA binding / transcription initiation factor3873e-037
AT5G05420.1 immunophilin, putative / FKBP-type peptidyl-prolyl cis-trans isomerase, putative1912e-014

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
191  3%
 
201  3%
 
616  40%
 
811  28%
 
105  13%
 
91  3%
 
113  8%
 
122  5%

Unigene MembersMember information