Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN08940

FASTA Sequence
Unigene ID: UN08940Length: 907  SNP
GGATCCATGCCACTTCTCTTTCTCTTGTCTTGGCAAAGTTTTGGGATCTTACACAACAACAACCACAACAAACAACAACCATATAT
TTGTCTTATTTGTATCATTTGTCCCCTTGTGTTCTTTATCTTAAGGAAAGTAAAATCTTGATTAATCTGAATAATGATGGGAGCAA
ATGATGGGAGAAGAACGCCTTTAATGAATCTTGGGGTTCAAGTATCGATGAGAGTATTAGCCATTGGCACTGCATTGGCCTCCATG
GGGCTCACGATCACTAACCATGAAGTCGCCTCTGTTTATGGCATTAATTTTGAGGCTAAATACGACTACTCATCTGCCTTTAGGTA
TTTGGTGTACGCAGAAATAGCTATCGCCGGCATGACATTGTTTACGCTCGTATGGGCTTGTTTAGCTGTCCGTAGAAGAGGACTTG
TTTTTGCACTCTTCTTCTTTGATTTGCTCACGACATTGACGGCTATATCGTCTTTCTCTGCGGCCATGTCGGATGGTTACATCGGC
AAGTATGGTAATACACACGCCGGTTGGCTACCGATATGCGGCTACGTCCATAATTACTGTAACCGTGTTACTCTCTCACTCGCTTT
GTCCTTCGCATCTTTTCTCCTCTTGTTCATCCTTACAGTCTTAACTGCCTCAGCTGCTCGTCATTTCTGATTAACTTTCTTTACGT
TTTCATATTATACATTTGCTTAAATTCTCATGATTTTTCAAGCTTTCTTATACTACTTACTATTATAAGATGAAAAATCAAAAGAA
AGAAATTGTATCCTTCCGTGAAATGTTTGTCCTTGAGACTCTTGTTATTTGTTATGTTCAAGTCTCGTCTTCATTTGGGACTCTTG
TTACGTGTGCATTTCAATACTAATCAACCCCTCTCTATATTCAAATG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_194234 uncharacterized protein [Arabidopsis thaliana]7323e-075
AAM63685 unknown [Arabidopsis thaliana]7271e-074
XP_002869692 integral membrane family protein [Arabidopsis lyrata subsp. lyrata]7242e-074
CAB36746 putative protein [Arabidopsis thaliana]6042e-060
XP_002280714 PREDICTED: hypothetical protein [Vitis vinifera]3013e-025

Swiss-Prot top hits (Blast detail)Scoree value
Q9M0L3 UPF0497 membrane protein At4g250407321e-076
A7PHN8 UPF0497 membrane protein 83011e-026
B9RA90 UPF0497 membrane protein 112948e-026
B9RH17 UPF0497 membrane protein 132714e-023
B9RW00 UPF0497 membrane protein 92355e-019

TrEMBL top hits (Blast detail)Scoree value
B9I3X5 Predicted protein2761e-022
B9N3F4 Predicted protein2662e-021
B9H2V1 Predicted protein2412e-018
B9N5U6 Predicted protein (Fragment)2366e-018
B9PBA8 Predicted protein (Fragment)2071e-014

Arabidopsis top hits (Blast detail)Scoree value
AT4G25040.1 integral membrane family protein7339e-078
AT4G03540.1 integral membrane family protein2231e-018
AT1G03700.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: hypocotyl, flower; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0497, trans-membrane plant (InterPro:IPR006702), Uncharacterised protein family UPF0497, trans-membrane plant subgroup (InterPro:IPR006459); BEST Arabidopsis thaliana protein match is: integral membrane family protein (TAIR:AT4G03540.1); Has 260 Blast hits to 260 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 260; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).1916e-015
AT5G06200.1 integral membrane family protein1559e-011
AT2G36100.1 integral membrane family protein1513e-010

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
79  27%
 
106  18%
 
129  27%
 
85  15%
 
61  3%
 
111  3%
 
92  6%

Unigene MembersMember information