Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN09126

FASTA Sequence
Unigene ID: UN09126Length: 1532 SSRSNP
GGAAAACTAACAGAATCCTCGGCGACAAAGAGTAGAGTAGTAGAGAGAGAGAGAGCACTACAAAGGCTTCGTTCCTTCCGCCGGAG
ATGGACAACGACTCAGTGGCGTCATCGCCGAGATCAGAGTACGATAACCAGCCACGTGTACGGTTCATGTGCACTTTCGGAGGAAG
GATCTTGCCTCGTCCGCCGGATAACCAGCTCTGTTACGTCGGCGGTGACAATCGTATGGTCGCCGTTCATCGTCACACATCTTTCG
CCTCTCTCCTCAGTAAACTTGCTAAACTCTCCGGTAAAAGCAACATGCGCGTGAAGTACCAGCTACCAAACGAGGATCTTGACGCG
TTGATCTCCGTATCAACGGACGAGGATGTAGAGAACATGATGGAAGAATACGACCGCGTCGCACTGAATCAAAACCCCCGCTCTTC
TCGTCTCCGTCTCTTCCTCTTCGCCAAAAACATCGCCGGAGAAGAAGAAGATAACGATAGTCGAGCAAGCAGCATCAGCTCTCTCC
TCGATAGCTCCGTCAATCGAGAGCAGTGGTTCCTCGAAGCTCTCAATCACGGCTCCTCCGCCGCATCTAACGGTGGTTCCAGCAAA
GGTTTCGAGCGCGTCAGGTCTGAAGTCTCCTCGATCGTCTCCGAAGTTCCTGATTACCTCTTCGGGTTGGATCATTTCGACGAGAC
TGCTCCGCCGAACGACCGTGATCCGAGAGCTAAGATCCGACGAGAAGCCTCGACGCTTTCGGATCCTGGCTCGCCTCGTCGTGATG
TTCCTTCGCCGTATGGTTCAACCTCTTCGGCTCATGTGATCACGTCATCTACACCGGAACTTCCACCGGTTAAAATTAAACCGGAA
AGTCCAGAAACGGTTTTGACTCCAAAAGCCGATCCTCAACCGGAGCGAGTAATTCAACAGATTCCGGTTAACTCGCAATGGCAGTA
CGTTGCCCCTGGCCCACAGTTTCATTACCAACCACCGGTTTATATGGTTCAACCGGGCAGTCATATGGTTCAACGAGGTAATCATA
TGGTTCAACAGAATAATCATATGGCTCAACCGGTTCTAATGCCGGGTCAGCGTATTCCACAATACCAGCATGTACCGATGGGATAC
CATCACCAACCACAGCCTCATCAGATTCCTGGTCTGGGTCAAGTATATGGTGAAACGGGTAGGCCGGTTATGATGGCAGTTGATGG
AGTCAGCCGTACTGCTTATTATGGTATGAATGCATCCGGTCCGGTTCAGATGTATCATCATCAACCTGGTATGGTTGTCCCAGGCG
TAGAAGAAAAATACAGAACTAAAACGGATTCGGATCCGGGTGGGGTGTGAAAGTCATCTTCGTCCTTGAGGCGTGTCTCAGCATGA
ACTGTGTAATACATTTCTCTGCTTTATTTAATCTTTTGTGTAATTTTGTCAACTTTTTTATACAAACTACGATAACAAAATGAAAC
CCAATGTCAACATCTTGTAATAAATAATAAATATACATCTGTGATTTGCGACACAATTTGCCAAAAAAAA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_567290 octicosapeptide/Phox/Bem1p domain-containing protein [Arabidopsis thaliana]13958e-152
BAE98505 hypothetical protein [Arabidopsis thaliana]13958e-152
XP_002872737 hypothetical protein ARALYDRAFT_490165 [Arabidopsis lyrata subsp. lyrata]13912e-151
CAB81057 putative protein [Arabidopsis thaliana]13804e-150
BAF01600 hypothetical protein [Arabidopsis thaliana]8993e-094

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q0WWJ3 Putative uncharacterized protein At4g05150 (Fragment)13955e-152
Q940N7 AT4g05150/C17L7_7013955e-152
Q9M0Y0 Putative uncharacterized protein AT4g0515013803e-150
Q0WMQ0 Putative uncharacterized protein At4g05150 (Fragment)8992e-094
Q2HTU9 Octicosapeptide/Phox/Bem1p6724e-068

Arabidopsis top hits (Blast detail)Scoree value
AT4G05150.1 octicosapeptide/Phox/Bem1p (PB1) domain-containing protein17403e-194
AT2G01190.1 octicosapeptide/Phox/Bem1p (PB1) domain-containing protein3918e-038
AT3G18230.1 octicosapeptide/Phox/Bem1p (PB1) domain-containing protein3138e-029
AT5G57610.1 protein kinase family protein2743e-024
AT5G64430.1 octicosapeptide/Phox/Bem1p (PB1) domain-containing protein2743e-024

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
62  20%
 
212  20%
 
191  10%
 
202  20%
 
92  20%
 
101  10%

Unigene MembersMember information