Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN09285

FASTA Sequence
Unigene ID: UN09285Length: 1463  SNP
GGACAGAAACTCAACAATGTCTTCCACAAAACCCATCTCGCTCCTTGTCTCCATCACTTTCTTCTTCTCCCTCCTCCTCAGCTCAT
CCTCCGCTCAGTCCGTCGTCAAAGCTTCCTACTGGTTCCCGGGAAGTGAGTTCCCCGTCACCGACATTGACTCGTCTCTCTTCACT
CACCTCTTCTGCGCCTTCGCTGACCTCAACTCTCAAACCAACCAAGTCACCATCGCCTCCGCGAACCAACAGAAGTTCTCCACCTT
CACTCAAACCGTACAACGGCGAAACCCTTCGGTCAAAACCCTTTTGTCCATCGGCGGTGGAGCCGCTGATAAAACAGCGTTTGCGT
CCATGGCAAGTAACCCCACTTCTCGAAAATCTTTCATTGATTCTTCGATAAGACTTGCGAGGTCGAATGGTTTCCACGGTCTTGAC
CTAGACTGGGAGTATCCGAGCAGTGCCGCGGAGATGAGCAACTTCGGTACGCTGCTTCGAGAATGGCGATCAGCGGTTGTAGCAGA
AGCTAGTAGCAGTGGTAGACAGCGTTTGCTTTTGGCGGCTGCGGTTTTCTACTCAAACAACTACTATTCGGTTCTGTATCCGGTTC
AAGCCGTTGCCGACAGTCTGGATTGGGTTAATCTTATGGCCTATGATTTTTATGGACCGGGTTGGTCTAGAGTAACCGGTCCACCT
GCCGCTTTGTATGACCCTTCAAACGCAGGTCCAAGAGGAGACGCTGGAGTGAGATCATGGACACAAGCTGGACTTCCAGCGAAGAA
AGCAGTCTTGGGATTTCCATACTACGGCTACGCATGGACTCTCTCAAACGCAAACAGTCACAGCTACTACGCGCCTACAACCGGAG
CGGCTATATCACCGGACGGTTCTATCGGATACGGTCAGATAAGGAAGTTTATAGTGGACAACAGAGCGACAACGGTTTATAACGCC
TCGGTGGTCGGAGATTACTGTTACGCAGGGACGACTTGGATTGGATACGATGATAATCAGAGTATCGTGACCAAAGTGAGATACGC
TAAGCAGAAAGGTTTGCTTGGTTACTTCTCGTGGCATGTGGGAGCTGACGATAATTCTGGTCTATCTCGTGCAGCGACACGTGCAT
GGGATGCTGCGGCAACCACCAGAACTATACAGAAGTTTTAAGGTTCTCCACTGTACGGGACTATGGCAAGTGGAATAGTTTTCTCA
GTCACTATACAAAGAAATAAGCGTTACTATTTGCGTATATGTTGTCAAAGGAAAAGGGAACAATAAGACATTACGATAATAAAAGC
AAGAAGTACAAGTTATATGCTTCTTTTATTAAGTAGCAAATCTACAAAATTTAAATGAAATACATTATCTGATACGTTTGATATCA
TATTTTGCACGTTCTCGTGTAAGATGAGCCATGCGTACGTGGTTAACAAGAACTGATGCTGAAATAAATGGACAAATCTGTAACGT
C

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002867920 glycosyl hydrolase family 18 protein [Arabidopsis lyrata subsp. lyrata]17811e-196
NP_193716 Glycosyl hydrolase family protein with chitinase insertion domain [Arabidopsis thaliana]17702e-195
3AQU Chain A, Crystal Structure Of A Class V Chitinase From Arabidopsis Thaliana17164e-189
BAE99745 putative chitinase [Arabidopsis thaliana]15363e-168
NP_193717 Glycosyl hydrolase family protein with chitinase insertion domain [Arabidopsis thaliana]13752e-149

Swiss-Prot top hits (Blast detail)Scoree value
Q13231 Chitotriosidase-14365e-042
Q9WTV1 Chitinase-3-like protein 14284e-041
Q15782 Chitinase-3-like protein 24123e-039
Q5RBP6 Chitinase-3-like protein 14105e-039
P36222 Chitinase-3-like protein 14062e-038

TrEMBL top hits (Blast detail)Scoree value
O81862 At4g1981017702e-195
Q0WT03 Putative chitinase15362e-168
O81863 Putative chitinase13751e-149
B9SBZ8 Chitinase, putative12665e-137
B9P5J8 Predicted protein12593e-136

Arabidopsis top hits (Blast detail)Scoree value
AT4G19810.1 glycosyl hydrolase family 18 protein17709e-198
AT4G19820.1 glycosyl hydrolase family 18 protein13756e-152
AT4G19800.1 glycosyl hydrolase family 18 protein12538e-138
AT4G19750.1 glycosyl hydrolase family 18 protein11481e-125
AT4G19760.1 catalytic/ cation binding / chitinase/ hydrolase, hydrolyzing O-glycosyl compounds11085e-121

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
66  27%
 
92  9%
 
83  14%
 
121  5%
 
181  5%
 
218  36%
 
191  5%

Unigene MembersMember information