Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN09363

FASTA Sequence
Unigene ID: UN09363Length: 1132  SNP
TTTTTCGAGCCCAAATTCAGCCGTTTAGAGCCTCAAACAGGCTGCCGAATGTTACGGGCTGTGAACGAGATGCGATTCGCTGTTTC
CGGTTGCTTTTGCAGTTTACTACATCAAATTTCATACATTTTGATGCATGGAAAAAGTAAAAAAAAAAAAAAAAAAACTTGTGGGC
TCCACGCAAATCTACTCGTGCTCTCCGACGAAAAGGATATATGGAATCGCGAGTCATGTACTAACGGGTGCGATCATACCAGCACT
AATGCACCGGATCCCATCAGAACTCCGCAGTTAAGCGTGCTTGGGCGAGAGTAGTACTAGGATGGGTGACCTCCCGGGAAGTCCTC
GTGTTGCACCCCTTTTTATTTTTTTTTCTTCATTTTGAAACGCGTCTCATCTTTAAAACCCCATAACTTTTTAACCGTGAGGAACT
ACGCCGCCCACAGCACCATTTCGGAAAGCCCCCAAAACCATCTAGGTCAGTGAATAGGCCTGGCCATTTTTCGAGCCCAAATTCAG
CCGTTTAGAGCCTCAAACAGGCTGCCGAATGTTACGGGCTGTGAACGAGATGCGATTCGCTGTTTCCGGGTGCTTTTGCAGTTTAC
TACATCAAATTTCATACATTTTGATGCATGGAAAAAGTCAAAAAAAAAAAAACTTGTGGGCTCCACGCAAATCTACTCGTGCTCTC
CGACGAAAAGGATATATGGAATCGCGAGTCATGTACTAACGGGTGCGATCATACCAGCACTAATGCACCGGATCCCATCAGAACTC
CGCAGTTAAGCGTGCTTGGGCGAGAGTAGTACTAGGATGGGTGACCTCCCGGGAAGTCCTCGTGTTGCACCCCTTTTTATTTTTTT
TTCTTCATTTTGAAACGCGTCTCATCTTTAAAACCCCATAACTTTTTAACCGTGAGGAACTACGCCGCCCACAGCACCATTTCGGA
AAGCCCCCAAAACCATCTAGGTCAGTGAATAGGCCTGGCCATTTTTCGAGCCCAAATTCAGCCGTTTAGAGCCTCAAACAGGCTGC
CGAATGTTACGGGCTGTGAACGAGATGCGATTCGCTGTTTCCGGGTGCTTTTGCAGTTTACTACATCAAATTTCATACATTTTGAT
GCATGGAAAAAGTC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002337775 predicted protein [Populus trichocarpa]1813e-011
XP_002862191 expressed protein [Arabidopsis lyrata subsp. lyrata]1795e-011
XP_002328889 predicted protein [Populus trichocarpa]1473e-007
EEC67196 hypothetical protein OsI_34071 [Oryza sativa Indica Group]1402e-006

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
B9P9V1 Predicted protein1812e-011
B9N103 Predicted protein1472e-007
B8BHJ4 Putative uncharacterized protein1401e-006

Arabidopsis top hits Scoree value
No hits found  

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
104  21%
 
66  32%
 
122  11%
 
191  5%
 
112  11%
 
92  11%
 
82  11%

Unigene MembersMember information