Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN09418

FASTA Sequence
Unigene ID: UN09418Length: 679  SNP
GGAACCAATACTTCTCTCTCAGTACTCATCTTTTAGAAACTCAAACAAAAAGAAACCAAACTAGTTTGAGTAGATCTAGAGGAGTG
TTTGGTTCTTTAAGAAAACAAAAATGGCTAAGTCATATGGAGCTCTCTTCCTCTTGGCCCTCGTTGTCTTCTCCTTGCTCCAAACC
ATGGTTATGGCCTCAAAGGGATCTGGAGGGAATTGGAACCCAAAACGTTATGGACCAGGAAGCCTAAAACGTTCCCAATGCCCGAA
GGAGTGCGATAGGAGGTGTAGCCAAACACAGTACCACAACGCGTGCATTTTATTCTGCAACAAATGCTGCAGAAAATGTTTGTGTG
TGCCTCCGGGTTACTATGGGAACAAACAAGTTTGCTCTTGCTACAACAACTGGAAAACTCAACAAGGTGGACCAAAATGCCCTTGA
AAACATCCCAATCGTTTTAATATTATCGGTTCCTTTTTATAATTAAAGTTTTCGATGATATTTATATTTCACTTTGATCCAACTGT
TGGTTTTGTGTTTCTTGTTCTATCTATTTTATTCCTAATGTTGTAATGCTATGCCACTCCTTTGGGACTTTGTTCTAAATCCCTTA
AAATATGAGAGTGGCCTATAAATGAATGATATTTTCATAAATAATAATTTGTTTTAAACTCTTCACAAACAAAATAC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_197027 gibberellin-regulated protein 4 [Arabidopsis thaliana]5223e-051
AAA74480 gibberellin-regulated [Arabidopsis thaliana]5215e-051
XP_002871654 hypothetical protein ARALYDRAFT_488368 [Arabidopsis lyrata subsp. lyrata]5081e-049
NP_001078587 gibberellin-regulated protein 4 [Arabidopsis thaliana]4373e-041
AAQ57667 Gasa4-like protein [Pelargonium zonale]4321e-040

Swiss-Prot top hits (Blast detail)Scoree value
P46690 Gibberellin-regulated protein 45222e-052
P27057 Protein GAST12712e-023
P47926 Protein RSI-12498e-021
Q948Z4 Snakin-11719e-012
P46687 Gibberellin-regulated protein 31654e-011

TrEMBL top hits (Blast detail)Scoree value
A8MQL8 Uncharacterized protein At5g15230.24372e-041
Q6V0P7 Gasa4-like protein4327e-041
A9P8E0 Predicted protein4291e-040
Q49RB3 Gip1-like protein4273e-040
B4UW77 Gibberellin-regulated protein4263e-040

Arabidopsis top hits (Blast detail)Scoree value
AT5G15230.1 GASA4 (GAST1 PROTEIN HOMOLOG 4)5231e-053
AT5G15230.2 GASA4 (GAST1 PROTEIN HOMOLOG 4)4389e-044
AT1G74670.1 gibberellin-responsive protein, putative3618e-035
AT2G30810.1 gibberellin-regulated family protein2882e-026
AT3G10185.1 Encodes a Gibberellin-regulated GASA/GAST/Snakin family protein2838e-026

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
105  16%
 
117  22%
 
76  19%
 
81  3%
 
98  25%
 
122  6%
 
211  3%
 
181  3%
 
141  3%

Unigene MembersMember information