Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN09425

FASTA Sequence
Unigene ID: UN09425Length: 1627  SNP
GGGTGGCAGATGTTTGAAACCAGTGGAGGAGAAGGAGAATGGGAGATCTCTACGCTCTGGACTTCGACGGAGTTCTCTGCGATAGT
TGTGGTGAAAGCTCTCTCTCTGCTGTTAAGGCTGCGAGAGCGAGGTGGCCTGGTCTGTTCCAAGGAGTTGACTCAGCTTTAGAGGA
ATGGATCGTTGATCAGATGCATATTGTGAGACCTGTGGTGGAAACTGGCTATGAAAATCTTCTGCTTGTTCGTCTACTGTTGGAGA
CTAAGATGCCCTCTATTCGAAAATCTTCAGTTGCAGAGGGATTGACTGTTGATGGGATATTGGAGAGCTGGGGAAAGATTAAGCCG
GTTATCATGGAAGCTTGGGGTGAAGAAGATAAAGAAGCTTTGATCGATTTGTTTGGTAAAGTTAGAGATGATTGGATTAACAATGA
CTTGACTACTTGGATTGGTGCCAATAGATTCTATCCAGGAGTATCAGATGCATTGAAGTTTGCCAGCTCAAAGATTTACATTGTTA
CCACGAAACAGGGCCGGTTTGCAGAAGCGTTACTACGTGAAATAGCAGGTGTGATCATACCACCAGAAAGGATCTATGGTCTGGGT
ACAGGCCCAAAGGTGGAAGTGCTAAAGCTACTTCAGAACAAACCAGAGCACCAGGGCTTGAAGCTGCATTTCGTGGAAGACAGACT
CGCAACGCTGAAGAATGTCATCAAAGAGCCTGAACTAGACAAATGGAATCTATACCTAAGTAACTGGGGCTACAACACAGAGAAAG
AAAGAGCAGAGGCAGAGAGCATTCCAAGAATTCAGGTTATTGAGCTTTCCACATTTAGCAATAAGCTTAAATGAGTCCATACTCAT
CAGAAAGAAAAAAACAAGCTTCCCTTTTCATTGTATTCTACAAGCCAAACATGTCAAAGAAACTGTAGCTACGATTCAGCTAAAAG
AGATAAACTTTTCCATCTCATAACTCATCCTTGTTGACATCATTGTTGCTATTACCATCACTATCTTCATCATCCTTGCTCTGCTT
AGCTTTAAGTTTGTCAACGACATCATCAAGAGGAGGATCACCAGGTCTTCGAAACTCTTGTTTCCCTATCTTAACCTCATAAGCCT
CTTCTTGGCTCAGCACAAACTCCCTTAGCTCAGTTACTTCCTTGCCGTTTTGCAAATTGAACATCAACGTGGCTCCGATCCACGGC
CATGAATCTCACTCCTAACCCACCTGTTCTCAGAACCTTGGTCCATTTCATAGCAATCTCCACCACCATATCCTTAGTACGGTTAA
CACCTAACCGGAGCTTGACGAAACCGACGACGGGTGCGAAAGTGCGTTTAGCCATCTCCTCTTGGATCTGATCGAATCCCATGTTG
GAGAAATCGGGAGGAGGATCGAACTCCGGCATGGCTGCTTTGTTCCCCCAATGCTTCCATGATTCGTCTTCTTCGTTGTCTTCCAC
GTCGTCTAGATCGTCGGTGATCTCGATCCGTCGCTTCCCCGCTTCCACGGATTCGTGGAAGTTCGAGATCAGGAGAAAGACGATGA
TGCAGCAAAGTAGAGAGGAAGGCGAGATCTTCTCCATGGTGGTTGTGTGAATCTGTGATCACTTTTAGTTAGAGATCCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002880212 hypothetical protein ARALYDRAFT_904052 [Arabidopsis lyrata subsp. lyrata]12982e-140
NP_566060 uncharacterized protein [Arabidopsis thaliana]12802e-138
NP_001031546 uncharacterized protein [Arabidopsis thaliana]12075e-130
XP_002511878 conserved hypothetical protein [Ricinus communis]11637e-125
ACU24371 unknown [Glycine max]11531e-123

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
O82790 AT2G45990 protein12801e-138
Q2V404 Putative uncharacterized protein At2g45990.312111e-130
B9RDT9 Putative uncharacterized protein11681e-125
B9I8L1 Predicted protein11554e-124
C6TN79 Putative uncharacterized protein11537e-124

Arabidopsis top hits (Blast detail)Scoree value
AT2G45990.1 unknown protein12815e-141
AT2G45990.2 unknown protein12815e-141
AT2G45990.3 unknown protein12322e-135
AT2G45990.4 unknown protein9983e-108
AT2G46000.1 unknown protein5324e-054

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
73  17%
 
66  33%
 
94  22%
 
123  17%
 
111  6%
 
81  6%

Unigene MembersMember information