Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN09442

FASTA Sequence
Unigene ID: UN09442Length: 1723  SNP
GGGAAAATGAAACACTCTAGCTCCAAAAGAGGCAATCAAACAAACAAGCAGAGAGCTTCTTAATAACCAAACTCTGCTTCTGAACA
GAGTAGAGAGAGTTAGAGAGAAAAAAAGACATGGAAGCCATGAAGGAGACTGTGGATCAGAGCTTGAGAGAGATGAGAGAGACATT
TGCGAGCGGTAGGACGAGGAGTGTGAAGTGGAGGAAGACACAGCTTGAAGCTATAATCGAGATGGTCAAAGACAACGAAGACAAGA
TGTGCGAGGTTCTGTTTCAAGATTTGGGCAAACACAGTACTGAAGCTTTTAGAGATGAGCTTGGTTTTGTCATGAGATCAGCTACT
ACTGCTTTAAGCAGTCTTGATAAATGGGTTGTTCCCAGAAAGAGCAACCTTCCTCTGTTGTTCTACCCAGCAACAGGGAAAGTGAT
CTCAGAACCGTATGGGACGGTTCTTGTTCTGTCTAGCTGGAACTTTCCTATTTCTTTGTCTTTGGACCCAATGATTGGGGCAATAT
CAGCAGGAAATACCGTGCTACTCAAGGCATCTGAACTGAGCCCTAACGCATCTGCCTTCCTCGCCAAGACGATCCCGTCTTATCTA
GACACTAAAGCCATCAAAGTTATCGAAGGAGGACCTGATGTCGCGACTATCCTCTTGCAGCATCAATGGGATAAGATCTTCTTCAC
TGGGAGTCCAAGAATCGGAAAGATTATAATGGCTGCAGCTGCAGAGCATTTGACTCCTGTGACATTGGAGCTTGGTGGAAAATGTC
CCACCATTATTGATCACCACTCTGTTTCAAAGGACATGAAGTCGATTGTGAAGAGGATCTCGGGAGGAAAATGGGGATCTTGCAGT
GGACAAGCTTGTATCTCCGTTGATTACGTTCTTGTTGAACAGAGTTTTGCGTCTTCTCTGATTGAAATGTTGAAGCCGGTGATAAA
GTCTTTCTTTGGAGAAAACCCTAAAGAATCAGGATGTCTAGCTAGGATTGTCACCAAGAAACATTTTCAGAGATTGTCTCGTCTTC
TTAATGATCCTCGTGTTCAAGCTTCAATCGTCTATGGAGGCTCCATGGATGAAGAGAAGCTGTATGTTGAGCCAACGATCTTGTTG
AATCCTCCTCTTGATTCTGAGATAATGAATGAAGAAATATTTGGTCCAATTCTCCCAATCATCACATTACGTGACATCCAAGAAAG
CATAGGGTTCATCAAGTCAAAACCAAAGCCACTTGCCATCTATGCATTCACCAAGGACGACAAACTTAAAACTAGAATCTTGTCAG
AAACATCCTCTGGAAGTGTTACCTTCAACGACGTCATGATCCAGTATATGTGTGATGCGTTGCCCTTTGGAGGAGTGGGAGAGAGT
GGAACAGGAAGGTATCACGGGAAATACTCATTTGAATGTTTCAGTCACGAGAAGGCAATAATGGAAGGAAGTTTAGCAATGGATCT
TGAAGCTCGATACCCTCCATGGAACACCTTCAAGCTCACCTTTATTAGACTCGCATTTCGTGAAGCTTACTTCAAGCTTGTCCTCT
TAATGCTTGGTCTTAAAAAATAAAATAAGGGAGCGAGAAGAGAAACACACGCAATATATATTATGTGATTGATTTGTATCACTCTT
ATGTTTGATTTTCATATCTTCACCTAATAAGTTTGATAATATATGTCATTCAAGCTATGAGATATTCTATATAAGCAACTTTCACA
TAT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002869039 ALDH3F1 [Arabidopsis lyrata subsp. lyrata]22632e-252
NP_195348 aldehyde dehydrogenase 3F1 [Arabidopsis thaliana]22282e-248
CAE48163 putative aldehyde dehydrogenase [Arabidopsis thaliana]21979e-245
XP_002273358 PREDICTED: hypothetical protein [Vitis vinifera]16663e-183
CBI17422 unnamed protein product [Vitis vinifera]16663e-183

Swiss-Prot top hits (Blast detail)Scoree value
Q70E96 Aldehyde dehydrogenase family 3 member F122281e-249
Q70DU8 Aldehyde dehydrogenase family 3 member H111723e-127
Q8W033 Aldehyde dehydrogenase family 3 member I1, chloroplastic11312e-122
Q8VXQ2 Aldehyde dehydrogenase11203e-121
P30839 Fatty aldehyde dehydrogenase9402e-100

TrEMBL top hits (Blast detail)Scoree value
A4FVT2 At4g3625022282e-248
B9HFC3 Predicted protein16554e-182
C4JBD6 Putative uncharacterized protein14493e-158
B9GF13 Predicted protein14476e-158
B6TXC0 Aldehyde dehydrogenase 3B114451e-157

Arabidopsis top hits (Blast detail)Scoree value
AT4G36250.1 ALDH3F1 (Aldehyde Dehydrogenase 3F1); 3-chloroallyl aldehyde dehydrogenase/ aldehyde dehydrogenase (NAD)22297e-251
AT1G44170.1 ALDH3H1 (ALDEHYDE DEHYDROGENASE 3H1); 3-chloroallyl aldehyde dehydrogenase/ aldehyde dehydrogenase (NAD)11722e-128
AT1G44170.2 ALDH3H1 (ALDEHYDE DEHYDROGENASE 3H1); 3-chloroallyl aldehyde dehydrogenase/ aldehyde dehydrogenase (NAD)11722e-128
AT4G34240.1 ALDH3I1 (ALDEHYDE DEHYDROGENASE 3|1); 3-chloroallyl aldehyde dehydrogenase/ aldehyde dehydrogenase (NAD)11311e-123
AT1G44170.3 ALDH3H1 (ALDEHYDE DEHYDROGENASE 3H1); 3-chloroallyl aldehyde dehydrogenase/ aldehyde dehydrogenase (NAD)10872e-118

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
115  23%
 
101  5%
 
124  18%
 
93  14%
 
83  14%
 
76  27%

Unigene MembersMember information