Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN09456

FASTA Sequence
Unigene ID: UN09456Length: 1332  SNP
CATTTCTGACGAGTCGAGAAGAAGAAGAAAGAAGAATAGTCCGATCTGAACAAGCTAGGGTTTCGTCTATCATCAATCAATCTCCG
ATCAAATGGCAATGGCTGTTTTCCGTCGCGAAGGGAGGCGTCTCCTCCCTTCAATCGCCGCTCGCCCAATCGCTGCCACCACCCCG
TCTCCTCTCTCTTCTGACCGGGAGGAGGGACCTTTTGGAGTTCGATCTATCTCTACTCAAGTGGTGCGTAACCGTATGAAGAGTGT
AAAGAACATCCAGAAGATCACAAAGGCCATGAAGATGGTTGCTGCTTCTAAGCTTAGAGCTGTTCAAGGACGAGCTGAGAACTCCC
GTGGTCTTTGGCAGCCATTTACTGCTCTTCTTGGAGATAATCCCAGCATTGACGTGAAGAAGAGTGTGGTGGTCACTCTCTCTTCT
GACAAGGGTCTCTGTGGTGGAATTAACTCCACTGTTGTTAAAGTCAGCAGGGCTCTCTACAAATTGAACGCTGGTCCTGAAAAGGA
CGTGAAGTTTGTTATCGTGGGAGAGAAAGCGAAAGCTATAATGTTTCGTGACTCAAAGAACGACATCTCCCTTACTGTCACAGAGC
TGAACAAGAATCCGCTCAATTATGCTCAGGTCTCAGTTCTTGCTGATGACATCCTGAAAAACGTTGAATTTGATGCTTTGCGCATT
GTCTACAACAAGTTCCATTCCGTTGTCGCATTTCTACCAACTGTGGCCACTGTGTTGTCCCCTGAGATCATTGAAAAGGAATCTGA
AGTTGGAGGAAAACTCGGTGAGCTTGACTCATACGAGATCGAAGGTGGTGAAACAAAGGGAGAAATTCTGCAGAATCTGGCCGAGT
TCCAGTTCTCTTGTGTGATGTTCAACGCGGTGCTGGAGAATGCGTGTAGTGAGATGGGAGCAAGGATGTCAGCAATGGACAGCTCA
AGCAGAAACGCAGGAGAGATGCTTGACCGTCTCACCCTCACTTACAACAGGACTCGCCAAGCTTCTATCACAACAGAGCTTATCGA
GATTATCTCTGGAGCTTCTGCACTTGAAGCTGCTAAATAAGCAAAGCACATCATCCTTGTTTTGCGTTAAACTTGGCTTTTGATAT
ATCTATATCTACCATAAAGGAGAAGAGTGTGTTTTGAACTCTTCAGGGCTACCGAAATCATTTTCTTTTACTGGCTTCTTGTTTTG
GCCAACCTGACTTGACTAAGATTTTTCTTACAATAAATTTCCCTGTAATTTCCAGCAAGTTTTGCAAACAAGAATGAAGAAACAGA
GGAGGAAAAAGCATAAGTAAGAAGCTGCTATGTTTTTATTAA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_180863 ATP synthase subunit gamma [Arabidopsis thaliana]15255e-167
AAM96955 mitochondrial F1-ATPase, gamma subunit (ATP3_ARATH) [Arabidopsis thaliana]15221e-166
XP_002881258 gamma subunit of mitochondrial F1-ATPase [Arabidopsis lyrata subsp. lyrata]15221e-166
BAE98585 mitochondrial F1-ATPase, gamma subunit [Arabidopsis thaliana]15212e-166
XP_002531492 ATP synthase f1, gamma subunit, putative [Ricinus communis]13123e-142

Swiss-Prot top hits (Blast detail)Scoree value
Q96250 ATP synthase subunit gamma, mitochondrial15252e-168
P26360 ATP synthase subunit gamma, mitochondrial12644e-138
B8IN02 ATP synthase gamma chain4491e-043
Q4FP37 ATP synthase gamma chain4491e-043
A1B8N9 ATP synthase gamma chain4463e-043

TrEMBL top hits (Blast detail)Scoree value
Q7GB12 ATP synthase gamma chain15254e-167
Q8L7F2 ATP synthase gamma chain15228e-167
Q0WWB3 ATP synthase gamma chain15211e-166
B9SZS3 ATP synthase gamma chain13122e-142
C6T8L7 ATP synthase gamma chain12782e-138

Arabidopsis top hits (Blast detail)Scoree value
AT2G33040.1 ATP synthase gamma chain, mitochondrial (ATPC)15314e-170
AT4G04640.1 ATPC1; enzyme regulator1533e-010
AT1G15700.1 ATPC2; enzyme regulator1335e-008

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
122  10%
 
83  15%
 
98  40%
 
64  20%
 
201  5%
 
191  5%
 
101  5%

Unigene MembersMember information