Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN09484

FASTA Sequence
Unigene ID: UN09484Length: 1113  SNP
GGATCTGTAAATATAGTAGTAATGTTTAATGGAATTAGGAAAGGGTTATTTTAGTCGCGTAATACACTCACTTATGGAAAGTACAA
TTTTACATATCAATTAGAAATACAAAAAGAAACTTTGAGGAAGTGATGAGTTTAAATAGTGTAGGGTGTAGGTAATGGCAAGCCCT
TGACGATACCGCAAAGGTTGGTGTTGAGTGGGATGTTGTATTCGTCTCTTAGAGATTTCTCAGGTGAGAGGACACTGACGTACATT
TGCTGTCCCAAGTATCTTCTCTCCCAGTTCTCTGATCTGATGTTCCACATACCAGCATTGTCGAATGTCAAGAGGATGGCGGACCA
GGACTTGGGGAACACTTGCACGGTGTGTCTGCTGACGGCATCGAGCAAGTTGTAGTTGTTTCTCTTCTCTGGTGTCCATGTTCCGG
GCTCAGAGGCGACTGAGAAGAATGAGTAACCATCCAAATTGAAGGATTGCATGCTCTTCTCATGGTTCTCGAAGACGATTTCCACA
AAGGTACGGAAAGTGATGTTCAAAACATTGGGCTCGACGGTTAGTGTTGTGATCTTGGCTGCTGGCTCGTCCTTGATGACGTTGTA
TTTGAAGACCTTCTCGGACATCTCGAAGTACTCAGCAAGCTTCAAGGGAGTCTCGGTATCAATGTGTGATACACCGTTGAGTCCAA
ACCTGACCTTTCCGTCAACCAAGTTCTTGCTGTTGGCGAGCTTGATGGTACGGGTGATGTTGATCTTTCCGTAATGGTAAGATCCT
TGCGGGTTAGGTCTAGCCGCGCTGGCGGTTAAGTTCCACCTGAAGGATCTGAACTGGTTAAGAGACCAAGCCCATCCGACTGGAGC
CTTGGGAAGCTCACTTGAAGCCTGAACATTGCTTCCTTCGTAGCTCATCACACCGACGGTGCTCACTTGCTTCTTGAGGAACCTAG
TGGATGCAACCATGTAGTAGTTCTTGGCGGTTTGGTCAGCGGTCACGAGAACAGCGTAGCACTGTCCGACGTGGACGTCTAGTGAG
TCGTAGTCGTTCTGGAGAACGTGGGAGCCTTCCATCTCAACAAGCTTCATCTTGTGTCATTGGATCCTGAAGTTAAGTGTC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_187948 protein SKU5-like 13 [Arabidopsis thaliana]16366e-180
XP_002882820 hypothetical protein ARALYDRAFT_478721 [Arabidopsis lyrata subsp. lyrata]16294e-179
XP_002894511 hypothetical protein ARALYDRAFT_474617 [Arabidopsis lyrata subsp. lyrata]15613e-171
NP_564697 SKU5 similar 14 [Arabidopsis thaliana]15433e-169
AAD10639 putative pollen specific protein [Arabidopsis thaliana]15433e-169

Swiss-Prot top hits (Blast detail)Scoree value
Q00624 L-ascorbate oxidase homolog13073e-143
P29162 L-ascorbate oxidase homolog11452e-124
Q9SU40 Monocopper oxidase-like protein SKU56774e-070
Q9FHN6 Monocopper oxidase-like protein SKS26604e-068
Q8VXX5 Monocopper oxidase-like protein SKS16489e-067

TrEMBL top hits (Blast detail)Scoree value
Q9LJF1 AT3g13400/MRP15_316364e-180
Q9SMW3 At1g5556015432e-169
Q9ZVV3 T5A14.2 protein15432e-169
Q9ZVV4 At1g55570/T5A14_113183e-143
Q9LJF2 L-ascorbate oxidase; pectinesterase-like protein; pollen-specific protein-like13149e-143

Arabidopsis top hits (Blast detail)Scoree value
AT3G13400.1 sks13 (SKU5 Similar 13); copper ion binding / oxidoreductase16372e-182
AT1G55560.1 sks14 (SKU5 Similar 14); copper ion binding / oxidoreductase15431e-171
AT1G55570.1 sks12 (SKU5 Similar 12); copper ion binding / oxidoreductase13182e-145
AT3G13390.1 sks11 (SKU5 Similar 11); copper ion binding / oxidoreductase13145e-145
AT1G41830.1 SKS6 (SKU5-SIMILAR 6); pectinesterase8915e-096

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
76  27%
 
93  14%
 
64  18%
 
86  27%
 
111  5%
 
122  9%

Unigene MembersMember information