Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN09518

FASTA Sequence
Unigene ID: UN09518Length: 454 SSR 
GGGTCGTACATTTCTCTCTCTCTCTCTCTCTTGCTCTCCTCGCTCATCTACTCAGAGAATTTGTGCAAGGTTGAAAATGGCAGGAC
ACAAGGTTGCGCATGCCACACTTAAAGGCCCGAGTGTGGTGAAGGAATTAGTTATCGGTTTGGCGCTGGGTTTAGCTGCTGGTGGT
CTCTGGAAAATGCACCACTGGAACGAGCAGAGGAAAACCAGAGCTTTCTATGACTTGCTCGAGAGAGGCGAGATCAGCGTTGTCCA
CCCTGAAGAGTGAAATTCAACACTATGCCACCACTCTCTCGAGCTCTATTTTTATGTTATTATTATTGTTTCTTGACATCTTAGAC
AAAAGTTACCTGAGAGAAAGGGTTGATTGCTTAAGAAATAAACAACAAAACGGATATCTTTGTTAAATTTCAGAACATCTTTCTTG
ATTTTATTTGAATGTTTTTGGGAT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002880298 cytochrome c oxidase subunit VC family protein [Arabidopsis lyrata subsp. lyrata]3167e-028
XP_002866426 hypothetical protein ARALYDRAFT_496289 [Arabidopsis lyrata subsp. lyrata]3141e-027
NP_182260 putative cytochrome c oxidase subunit 5C-1 [Arabidopsis thaliana]3113e-027
XP_002862722 cytochrome c oxidase subunit VC family protein [Arabidopsis lyrata subsp. lyrata]3113e-027
Q9LZQ0 RecName: Full=Cytochrome c oxidase subunit 5C-2; AltName: Full=Cytochrome c oxidase polypeptide Vc-23078e-027

Swiss-Prot top hits (Blast detail)Scoree value
O22912 Probable cytochrome c oxidase subunit 5C-13112e-028
Q9LZQ0 Cytochrome c oxidase subunit 5C-23076e-028
Q9FLK2 Probable cytochrome c oxidase subunit 5C-33068e-028
Q8VY39 Cytochrome c oxidase subunit 5C-22808e-025
Q9SXX7 Cytochrome c oxidase subunit 5C2744e-024

TrEMBL top hits (Blast detail)Scoree value
Q2HIR0 At5g613103067e-027
A1YMW4 Cytochrome-c oxidase3004e-026
D6BR49 Cytochrome c oxidase polypeptide Vc2861e-024
B9RNE3 Cytochrome c oxidase polypeptide Vc, putative2843e-024
C6T2P2 Putative uncharacterized protein2753e-023

Arabidopsis top hits (Blast detail)Scoree value
AT2G47380.1 cytochrome c oxidase subunit Vc family protein / COX5C family protein3122e-029
AT5G61310.1 cytochrome c oxidase subunit Vc, putative / COX5C, putative3076e-029
AT5G61310.2 cytochrome c oxidase subunit Vc, putative / COX5C, putative3076e-029
AT5G61310.3 cytochrome c oxidase subunit Vc, putative / COX5C, putative3076e-029
AT5G61310.4 cytochrome c oxidase subunit Vc, putative / COX5C, putative3076e-029

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
62  67%
 
91  33%

Unigene MembersMember information