Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN09577

FASTA Sequence
Unigene ID: UN09577Length: 1475 SSRSNP
GGACACTCACTCCTTTCCTATTTCTTCGCTTTGCGTGCCCTTCCTTCTTCTTCTTCTTCTTATCAACAACTTGCATCAGCAAAAAG
CTATAACTACCTAATACTATCATTTAATAAAGACCCCAACTTTCTTGTGACTTCTCTCTGTTCGTTCGCTGTGATCTCTCTGTTTC
TCTCTCTTATCCGAAAGAATCGATCTTTCGAAGTGGGTTCTCTTTGCTTGCTACTCTCGATATGGGTTCGTCTGTGGAGCAGAACA
TTCTTGTCACTGGCGGTGCTGGATTCATCGGGACGCATACCGTTGTTCAGCTCCTGAAGGAAGGTTTTAAGGTCTCGATCATCGAT
AACCTCGACAACTCTGTTATCGAAGCCGTCGACAGGGTTAGGGAGCTCGTTGGTCCTCATCTCTCCAAGAAGCTCAACTTTACTCA
GGGTGATCTAAGAAACAAAGGTGATATTGAGAAACTCTTCTCCAAACAGAGGTTTGATGCTGTGATCCATTTCGCGGGTCTTAAAG
CTGTGGGTGAAAGTGTTGCCAACCCTCGCCGCTACTTTGACAACAACTTGGTTGGAACTATCAATCTTTACGAGACCATGGCCAAG
CACAACTGCAAAAACATGGTGTTTTCATCGTCTGCGACTGTGTATGGACAACCTGAGAAGATTCCATGCATGGAAGACTTCGAGTT
GAAGGCTATGAATCCTTACGGTCGTACTAAGCTCTTTCTTGAAGACATAGCTAGAGATATCCAGGCGGCTGAACCAGAGTGGAGAA
TTGTGCTGCTGAGGTACTTCAATCCTGTGGGAGCGCACGAGAGCGGCAGAATTGGCGAGGATCCAAAGGGTATCCCCAATAACCTC
ATGCCTTACATACAGCAAGTAGCTGTTGGACGCCTACCTGAACTCAACGTCTATGGACATGACTATCCTACCGAGGATGGCAGTGC
GGTGAGGGACTACATCCATGTGATGGATTTGGCTGATGGACATATCGCTGCGCTAAGGAAGCTATTTGATGATCCAAAGATTGGCT
GTACTGCTTACAATCTAGGGACTGGACGAGGAACGTCTGTGTTGGAGATGGTTGCTGCTTTTGAGAAAGCTTCTGGCAAGAAAATA
CCGATCAAGCTTTGTCCGAGGAGGTCAGGAGATGCAACTGCAGTTTATGCTTCAACAGAGAGAGCTGAGAAAGAACTTGGCTGGAA
GGCAAAGTATGGAGTGGACGAGATGTGCAGAGACCAGTGGAATTGGGCAAACAACAATCCATGGGGTTACCAGAAGAAGCATTGAC
TTTTCACTCTTTCTCTAATCACTCAATATACAAAGAAAAGTGTTAACATACACACATCATATAGTTTGCTTTGCTTTCCATGTAAC
GAACGGGTCTTGTTACCTCTATGAATAAAACAGCTAGTTGACTGATGTATACATTCTATGGACCGTTCAAGATTCAGCAATACAAG
AAGATTTATTTGT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002892712 UDP-D-glucose/UDP-D-galactose 4-epimerase 1 [Arabidopsis lyrata subsp. lyrata]17667e-195
NP_172738 UDP-D-glucose/UDP-D-galactose 4-epimerase 1 [Arabidopsis thaliana]17578e-194
CAA90941 uridine diphosphate glucose epimerase [Arabidopsis thaliana]17335e-191
XP_002886429 UDP-D-glucose/UDP-D-galactose 4-epimerase 3 [Arabidopsis lyrata subsp. lyrata]16914e-186
NP_564811 UDP-glucose 4-epimerase [Arabidopsis thaliana]16861e-185

Swiss-Prot top hits (Blast detail)Scoree value
Q42605 UDP-glucose 4-epimerase 117573e-195
Q43070 UDP-glucose 4-epimerase15962e-176
O65780 UDP-glucose 4-epimerase GEPI4214993e-165
Q9SN58 UDP-glucose 4-epimerase 212743e-139
O65781 UDP-glucose 4-epimerase GEPI4812636e-138

TrEMBL top hits (Blast detail)Scoree value
Q8LDN8 At1g6318016869e-186
Q9CAM5 Uridine diphosphate glucose epimerase, putative; 80611-7878616733e-184
B9GWF3 Predicted protein16098e-177
B0M3E8 UDP-glucose 4-epimerase16025e-176
C6T9D7 Putative uncharacterized protein15936e-175

Arabidopsis top hits (Blast detail)Scoree value
AT1G12780.1 UGE1 (UDP-D-glucose/UDP-D-galactose 4-epimerase 1); UDP-glucose 4-epimerase/ protein dimerization17573e-196
AT1G63180.1 UGE3 (UDP-D-glucose/UDP-D-galactose 4-epimerase 3); UDP-glucose 4-epimerase/ protein dimerization16865e-188
AT4G10960.1 UGE5 (UDP-D-glucose/UDP-D-galactose 4-epimerase 5); UDP-glucose 4-epimerase/ protein dimerization12743e-140
AT1G64440.1 RHD1 (ROOT HAIR DEFECTIVE 1); UDP-glucose 4-epimerase/ protein dimerization12412e-136
AT4G23920.1 UGE2 (UDP-D-glucose/UDP-D-galactose 4-epimerase 2); UDP-glucose 4-epimerase/ protein dimerization12295e-135

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
91  9%
 
211  9%
 
101  9%
 
112  18%
 
122  18%
 
191  9%
 
181  9%
 
82  18%

Unigene MembersMember information