Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN09583

FASTA Sequence
Unigene ID: UN09583Length: 1437  SNP
AAAGGAAAAAAAAATAATATTCAATTGAGAAATGTTTTGATAAGTTACAAAAAATAGAGACAAACACCAAATGACTAAACAAGATA
AGATATACATCATTTTGTTTATACTTTTATTCAAAGCCAAAGAAGAATAACAGAAGCACAAAGTTTGAGAGAGATAAAATACACAA
AAAAACAAAAAAGAAGATCCCACATAAGATAATCACATAACTATCTCTGGCTTCAAGATGTTGGATTTGATCTCCTTGTGTGGCAA
AACAACCCCTCCATTGGTGTATATCTCATCCCCAACATGAACATCTTCCCCCAAGATCGTCATGTTCTCAATCCTAGCCCACTGCC
CAACCGTTGAGTGCCACCCTACGATACTGCTCGAGACACACGCATGCTTCTTGATCCTTGCCCCACGCATGACCGTGCACCGTGAA
AGCCTCACCCCTGACTCAACAACGCAGCCCGGACCAATGGCCACGTCTGGTCCTATCAAACACCCTTCTCCAATCTTAGCGGTTTC
ATCCACCAGAACGTTCCCAACAATGTGTGCACCGGTGGTTAGCTTGGCTGGAGACTTCTTCCTGAGAGAGTCTAAGTAGAGTCTCA
GGCCCGTTATGTAGTCCTTGGGTTGTCCAATGTCCATCCAGAATCCAGGTAGCACCATGGCGTAGAGCCCTTGAGCTGCTGCAATC
TTGGGGAAGGTCTCTTTCTCGATCGATGTTGGTCTTAGCTCAATCTTGTCGAGAACCGATGGGTTCAGAAGGTAAATCCCAGCGTT
GATCTTGTTGCCTACAAACAGTTTTGGCTTCTCCACAAACTTCTCAACTTTTCCTGTAGTTTCATCCATGACAACAACTCCATACT
TGGACGGTTCATCAACCTTTGTCACCATAATGGAGGCTTCACCACCGTGAGCTTTGTGAAACTCAATCATCTCTTTGAGAGGGTAC
TCACTGATCACATCACTGTTGAGGACAAAGAAGGGCTCTCCAGATCCATCAACCAGTTTGTCTCTAGCTAGAGCCAGAGGACCAGC
CGTACCCATAGGCTCAGTCTCTTGTGAGCAAGTGATTTTGATTTCGAGCTTTGCCTCAAAGTCCTTCAAGAAGTTAAGCATCACCT
CTGGTTGGTAATTGATGGCCAAAACCACTTCGTCAACTCCAACTGCCTTGAGCGCCTCTATCTGATGAAGGATCATGGGTTTGTTA
GCAAAGTCAACAAGGGGCTTTGGGAAACTGAGAGTCAATGGTCTCAAGCGAGTCCCGAACCCTCCAACAAGAATGAGAGCCTTCAT
CTTCTAGGACTCAAACTAGACTCTTTCTATTCCTTGGAAGAAGAGATCTCACGGGATCGAGAGATCTGAGATCGGAAACAAGAGAG
TTGGGGGGTCAGGCTGAGCTGTGATGATGAGGAAAGGAAAAGAGTTTTGTTGGCAAATCCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAJ34137 unnamed protein product [Thellungiella halophila]18293e-202
XP_002879816 hypothetical protein ARALYDRAFT_483004 [Arabidopsis lyrata subsp. lyrata]17981e-198
NP_181507 mannose-1-phosphate guanylyltransferase [Arabidopsis thaliana]17935e-198
CAC35355 GDP-mannose pyrophosphorylase [Arabidopsis thaliana]17821e-196
ABB53473 GDP-mannose pyrophosphorylase [Malpighia glabra]17201e-189

Swiss-Prot top hits (Blast detail)Scoree value
Q54K39 Mannose-1-phosphate guanyltransferase beta12198e-133
Q68EY9 Mannose-1-phosphate guanyltransferase beta-A11822e-128
Q9Y5P6 Mannose-1-phosphate guanyltransferase beta11822e-128
Q2YDJ9 Mannose-1-phosphate guanyltransferase beta11803e-128
Q68EQ1 Mannose-1-phosphate guanyltransferase beta11793e-128

TrEMBL top hits (Blast detail)Scoree value
O22287 At2g39770/T5I7.717934e-198
Q9C5B8 GDP-mannose pyrophosphorylase17827e-197
A0EJL9 GDP-mannose pyrophosphorylase17201e-189
C0KWD9 GDP-D-mannose pyrophosphorylase17145e-189
B9HT64 Predicted protein17111e-188

Arabidopsis top hits (Blast detail)Scoree value
AT2G39770.1 CYT1 (CYTOKINESIS DEFECTIVE 1); mannose-1-phosphate guanylyltransferase/ nucleotidyltransferase17941e-200
AT3G55590.1 GDP-mannose pyrophosphorylase, putative16077e-179
AT4G30570.1 GDP-mannose pyrophosphorylase, putative12842e-141
AT1G74910.1 ADP-glucose pyrophosphorylase family protein3138e-029
AT1G74910.3 ADP-glucose pyrophosphorylase family protein3138e-029

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
117  17%
 
102  5%
 
122  5%
 
2117  41%
 
72  5%
 
88  20%
 
91  2%
 
181  2%
 
191  2%

Unigene MembersMember information