Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN09660

FASTA Sequence
Unigene ID: UN09660Length: 719  SNP
GGGAATTTCCCAAAAAAGAAGAGCGAGAGTCTAATAATGGCGATGGAAGTAGCAACTCCGGTTAATGCACCGGCGCCATCTCCGGC
GACCAACCTCATTGTGTCAGCAACAACCGCGGTGGAAACTCAGAAGAAGAACAGGATCCAAGTGTCTAACACCAAGAAACCCTTGT
TCTTCTACGTTAACCTCGCCAAGAGATACATTCAACAACACAACGAGGTCGAGCTTTCTGCACTTGGAATGGCGATCACAACAGTG
GTTACTATCTCAGAAATTTTGAAGAACAATGGACTTGCAACAGAGAAGAAAGTTCTGACATCAACAGTGGGAATGAAGGACGAGAA
CAAAGGGAGAGTAGTTCAGAAGGCCAAGATTGAGATTGTATTGGGGAAATCAGACAAATTCGATTCTCTGATGACTCCGTTGACCA
AAGATACGGTGGTGCCGGAGGAGAAAGCGGTGAACACTGAGGAGAAACCAATAGAAGCTGAAGTTAAACCTGAAGGCAAGGAGTGA
TCATGTAAACAAATTTCTACGTGTTTCGAGTGTTAAACATAAGTTTCTTTGCATAATGAGCAAACTTTGCTTCATTACTAACTAAA
AAAACAAATCAAAAAATGTTTTGTGGAGTTATAGAAAGACAATCAAATGTTGTGTTGATGATTTCTTTTTATTACTCTCCCTCTTT
GTTGAACTATATAAAAAATTAAAATTGCTTT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002884455 nucleic acid binding protein [Arabidopsis lyrata subsp. lyrata]5565e-055
NP_187113 Alba DNA/RNA-binding protein [Arabidopsis thaliana]5531e-054
XP_002521944 conserved hypothetical protein [Ricinus communis]4883e-047
XP_002328484 predicted protein [Populus trichocarpa]4812e-046
XP_002285115 PREDICTED: hypothetical protein [Vitis vinifera]4185e-039

Swiss-Prot top hits (Blast detail)Scoree value
O22969 Uncharacterized protein At2g341604012e-038

TrEMBL top hits (Blast detail)Scoree value
Q9SR12 At3g046205537e-055
B9S7H5 Putative uncharacterized protein4882e-047
B9MZB4 Predicted protein4812e-046
A9SRM2 Predicted protein4157e-039
A9SRM3 Predicted protein4131e-038

Arabidopsis top hits (Blast detail)Scoree value
AT3G04620.1 nucleic acid binding5534e-057
AT1G29250.1 nucleic acid binding4102e-040
AT2G34160.1 nucleic acid binding4012e-039

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
112  17%
 
103  25%
 
121  8%
 
92  17%
 
62  17%
 
72  17%

Unigene MembersMember information