Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN09807

FASTA Sequence
Unigene ID: UN09807Length: 514 SSR 
TGAAAACAGAACAACCACAAACATAAAGAATCAAGAACCGGAAAATGGTGAAGGTGATGTGGGTTTCCGTTTTAGCTCTCGTGGCA
GCGGTTCTCCTCGTGACGGTGGAAAAACTTCCGGTGGCCGAAGGAGTGACCTGCTCGGTGACGGAACTGTCTCCATGTTTGGCGGC
GTTTATGTCATCTTCGTCACCGTCGGCGTCGTGCTGCGCCAAGCTGAGAGAGCAGAAGCCATGCCTTTGTGGGTACATGAGGAACC
CTAGCCTCCGCCAATACGTTAGCTCCCCAAACGCAAAAAAAGTCTCCAACGATTGCAAGGTTGCTTCCCCAAACTGTTAATCATGA
TTAATAAGTGACAAGTTTACCTGATTATGAGTGTTAAGTTACAAGTAAAAGTGGGTCTTGTCCTCTTTCACTAGTGTTTAATATAA
TAATGGGTGATGATCATCATCATCATCATCATCATCATCATCATGCTTGAATGTTATATGTATGTTTCTGTCTTGTAAAACATG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_564532 bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin-like protein [Arabidopsis thaliana]3643e-033
NP_188456 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein [Arabidopsis thaliana]3052e-026
AAG60123 lipid transfer protein, putative [Arabidopsis thaliana]2892e-024
AAA33933 lipid transfer protein [Senecio odorus]2838e-024
Q43681 RecName: Full=Probable non-specific lipid-transfer protein AKCS9; Short=LTP; Flags: Precursor2757e-023

Swiss-Prot top hits (Blast detail)Scoree value
Q43681 Probable non-specific lipid-transfer protein AKCS92754e-024
P82353 Non-specific lipid-transfer protein 22388e-020
A2XBN5 Non-specific lipid-transfer protein 21733e-012
P20145 Probable non-specific lipid-transfer protein1715e-012
Q10ST8 Non-specific lipid-transfer protein 21706e-012

TrEMBL top hits (Blast detail)Scoree value
Q94AQ3 Putative lipid transfer protein3642e-033
Q42158 Lipid transfer protein3615e-033
Q9LJQ3 AT3g18280/MIE15_73052e-026
Q9C743 Lipid transfer protein, putative2891e-024
Q41378 Lipid transfer protein (Fragment)2836e-024

Arabidopsis top hits (Blast detail)Scoree value
AT1G48750.1 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein3794e-037
AT3G18280.1 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein3061e-028
AT1G66850.1 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein2299e-020
AT2G14846.1 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein2047e-017
AT1G73780.1 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein2012e-016

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
103  38%
 
72  25%
 
82  25%
 
121  13%

Unigene MembersMember information