Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN09876

FASTA Sequence
Unigene ID: UN09876Length: 837  SNP
GGATAAGACAGCAGCAAACAGACATAGGACTTGGTGGAGAACTCCGGCGGCGACATGGGTGGTTCAATTTCTGTGTCTGAAAAATC
CATCCATGAATTCACTGTCAAGAATAGCTCCGGCAAGGAGGTTGACCTTAGCGTTTACCAAGGGAAGGTTCTTCTCGTCGTCAACG
TCGCTTCTAAATGTGGTTTCACGGAATCCAATTACACACAGCTTACTGAACTTTACCGGAAATACAAAGATCAAGGGTTTGTGATA
TTGGCGTTTCCTTGCAACCAGTTTTTGAACCAAGAGCCTGGTACAAGCCAAGATGCTCATGAATTTGCTTGTACCAGATTTAAGGC
CGAGTACCCTGTCTTCCAAAAGGTGCGTGTAAATGGACAAAACACAGCACCAGTCTACAAATTCCTCAAGTCTAAGAAACCATCAT
TCCTTGGAAGCAGGATCAAATGGAACTTCACCAAGTTCTTGGTCGGCAAAGATGGTCAAGTCATTGATCGTTATGGCCCCACTGTT
CCACCTCTCTCCATCGAGAAAGACATCAAGAAAGCCCTCGGAGACGCAGAAGCGTTTCCAAGTACTTAGCCCTTGAAGAAGAAGAA
GAGAGAGGCGAGAGGCTCTTGAAGAATTCGTCTCTTACTCTTTGATATCCACTCATTTTGTAGTTTCTCTGGTGATGATGTACAAG
TTTCTTCCATATACCTATTTGGGCCTTAGCATGAACGAAATATCCAAAGTCTATCTCGATAATTTATAAGTATAAAAATATCAACT
AAAAGATTCTAAAGAATAATATTTGTGTTTCTATAAAAAACAATTTTAAGTAGAACATTTTAT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAJ34328 unnamed protein product [Thellungiella halophila]8245e-086
XP_002876706 ATGPX5 [Arabidopsis lyrata subsp. lyrata]8131e-084
NP_191867 glutathione peroxidase [Arabidopsis thaliana]7969e-083
XP_002880346 hypothetical protein ARALYDRAFT_484007 [Arabidopsis lyrata subsp. lyrata]7628e-079
NP_566128 glutathione peroxidase [Arabidopsis thaliana]7564e-078

Swiss-Prot top hits (Blast detail)Scoree value
Q9LYB4 Probable glutathione peroxidase 57964e-084
Q8L910 Probable glutathione peroxidase 47562e-079
O23814 Probable phospholipid hydroperoxide glutathione peroxidase6092e-062
O48646 Probable phospholipid hydroperoxide glutathione peroxidase 6, mitochondrial5993e-061
O24031 Probable phospholipid hydroperoxide glutathione peroxidase5931e-060

TrEMBL top hits (Blast detail)Scoree value
B1PBX7 Glutathione peroxidase7625e-079
B9T4A6 Glutathione peroxidase7098e-073
C6SY48 Glutathione peroxidase6927e-071
A9PFP2 Glutathione peroxidase6792e-069
A2XGV4 Glutathione peroxidase6425e-065

Arabidopsis top hits (Blast detail)Scoree value
AT3G63080.1 ATGPX5 (glutathione peroxidase 5); glutathione peroxidase7964e-085
AT2G48150.1 ATGPX4 (GLUTATHIONE PEROXIDASE 4); glutathione peroxidase7562e-080
AT4G11600.1 ATGPX6 (GLUTATHIONE PEROXIDASE 6); glutathione peroxidase5993e-062
AT4G31870.1 ATGPX7 (glutathione peroxidase 7); glutathione peroxidase5553e-057
AT2G25080.1 ATGPX1 (GLUTATHIONE PEROXIDASE 1); glutathione peroxidase5501e-056

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
65  42%
 
82  17%
 
192  17%
 
111  8%
 
101  8%
 
71  8%

Unigene MembersMember information