Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN09896

FASTA Sequence
Unigene ID: UN09896Length: 1245  SNP
TTTTTAGGAGGGATTTTTAATTTCAACTCCCGAAAAAGTTCTGCATTTATCTTCTTCGCCTGTAGAGGTTTTCGAGGAGCTTTCAT
TACCAAGTCCTTCTCTATCCACTAACCTTTGCCTTAGATTGCTCGGGAAGTAGAAAGAGATTACTTAATGGCTCCCGCATTCGGCA
AATGTTTCACGTTCTGCTGCGCTAAGACCTCTCCGGAAGGAGACGAAATGGCCACGGATGCGTACGAAGCCGCCATCAAAGGACTT
AAGGATCTTCTCAGTAAGAAGGCAGATCTAGGGAACGTGGCCGCGGAGAAGATCAAAGAGTTGACTCAGGAGCTTAAGGAGCTTGA
TTCCAGCAACTCTGACGCCGTTGAACGTATCAAATCCGGTTTCACCCACTTCAAAACTCAGAAATACTTGAAAGATAGTGCTCGGT
TCAATGATCTCGCCAAGGGTCAGAGCCCAAAGTTTCTGGTATTCGCCTGTTCTGATTCTCGAGTGTGTCCATCTCACATATTGAAT
TTCCAACCTGGAGAAGCCTTTGTTGTCAGAAACATTGCAAACATGGTTCCACCTTTCGACCAGAAGAGACATTCTGGCGTTGGTGC
CGCCGTTGAATACGCAGTTGTACATCTCAAGGTGGAGAATATTCTGGTGATAGGCCATAGCCGTTGCGGTGGGATTAAGGGACTCA
TGTCCATTGAAGATGATGCTGCACCAACTAAGAGCGACTTTATAGAAAATTGGGTGAAGATCGGTGCATCAGCAAGGAACAAGATC
AAGGAGGAACATCAAGGCCTAGACGATGAAGCTAAATGCACCGAGTGTGAGAAGGAAGCTGTGAATGTGTCGCTTGGAAACTTGCT
TTCATACCCATTTGTGAGAGCTGAAGTAGTGAAGAACACATTGGCGATAAGAGGAGCTCACTACAATTTCGTCAAAGGAACCTTCG
ATCTCTGGGAGCTCGATTTCAAGACCACTCCTGCTTATGCCTTCTCTTGAACATAACTCTTGTGAGATTTGCGCTTTTCTCTCACA
AAAGCTTTGACTGCATCCTTTCTTTCTTCTCATGTTGATTCTGATCTCAACTTTTTTTTTATCATTTCCTTATTTCAGACTTTCAA
CTTTGCTGCTTCTGTTTCAAAAAGCTGTAAACAATAATACTCTGAACAACCTCTTAAGCTTTGTTTATTTCGTCTAAGTAACGTGT
TGTTCAAGAAAGACCCACTTGCTAGTATTGTTCGAATTAGG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002888778 hypothetical protein ARALYDRAFT_476161 [Arabidopsis lyrata subsp. lyrata]12998e-141
NP_177198 beta carbonic anhydrase 4 [Arabidopsis thaliana]12925e-140
NP_849872 beta carbonic anhydrase 4 [Arabidopsis thaliana]11789e-127
NP_173785 beta carbonic anhydrase 3 [Arabidopsis thaliana]9816e-104
XP_002890592 predicted protein [Arabidopsis lyrata subsp. lyrata]9781e-103

Swiss-Prot top hits (Blast detail)Scoree value
P27141 Carbonic anhydrase, chloroplastic8334e-088
P46512 Carbonic anhydrase 18102e-085
P46511 Carbonic anhydrase8057e-085
P46281 Carbonic anhydrase8012e-084
P46510 Carbonic anhydrase7967e-084

TrEMBL top hits (Blast detail)Scoree value
Q94CE4 Carbonic anhydrase12924e-140
O64595 Carbonic anhydrase11786e-127
Q9ZUC2 Carbonic anhydrase9814e-104
B9SHA8 Carbonic anhydrase9619e-102
Q5NE21 Carbonic anhydrase9115e-096

Arabidopsis top hits (Blast detail)Scoree value
AT1G70410.2 carbonic anhydrase, putative / carbonate dehydratase, putative12932e-142
AT1G70410.3 carbonic anhydrase, putative / carbonate dehydratase, putative11793e-129
AT1G70410.1 carbonic anhydrase, putative / carbonate dehydratase, putative11793e-129
AT1G23730.1 BCA3 (BETA CARBONIC ANHYDRASE 4); carbonate dehydratase/ zinc ion binding9822e-106
AT5G14740.1 CA2 (CARBONIC ANHYDRASE 2); carbonate dehydratase/ zinc ion binding8021e-085

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
85  31%
 
211  6%
 
92  13%
 
112  13%
 
191  6%
 
71  6%
 
101  6%
 
121  6%
 
62  13%

Unigene MembersMember information