Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN10204

FASTA Sequence
Unigene ID: UN10204Length: 1399 SSRSNP
TTTTTTCTGCTGCTACATTATACACATCTTCTCTCTCTCTCTCTCTCTGGTAGCCATGGCTTCGGCTACTTTCTCTGTGGCCAAAC
CATCTCTTCAGGGTTTCTCTGACTTCTCAGGACTCAGAAACTCCTCTGCTCTTCCCTTGGCCAAGAAAACTTCTTCTGATGAGTTT
GTTTCCTTCGTCAGTTTCCAGACTTCTGCAATGGGAAGCAATGGAGGATACAGGAAAGGAGTGACCGAGGCGAAGCTAAAGGTAGC
CATCAATGGATTCGGTAGGATCGGTAGGAACTTCTTGAGATGTTGGCATGGTCGTAAAGACTCTCCTCTTGATGTCATTGCCATTA
ACGACACTGGCGGTGTCAAACAAGCGACGCATCTCCTCAAATACGACTCAACTCTTGGAATCTTCGACGCTGACGTCAAGCCTTCA
GGAGACTCTGCTCTCTCTGTTGATGGAAAGATCATCAAGATTGTCTCTGACCGCAACCCATCCAACCTCCCCTGGGGGGAACTAGG
CATTGACTTGGTCATCGAAGGAACCGGAGTGTTTGTAGACAGAGAAGGTGCTGGAAAGCACATTCAAGCTGGAGCCAAGAAGGTTC
TGATCACTGCACCTGGTAAAGGTGACATCCCAACCTATGTGGTTGGTGTCAATGCTGAACTTTACAGCCATGAAGACACAATCATC
AGCAATGCTTCTTGTACTACCAACTGTCTCGCTCCATTCGTCAAGGTTCTTGACCAGAAGTTCGGGATCATAAAGGGTACAATGAC
AACCACTCACTCTTACACTGGCGACCAGAGGCTGCTAGATGCTAGCCACCGTGATCTGAGGAGAGCAAGAGCAGCGGCTCTAAACA
TCGTTCCGACATCTACAGGAGCGGCTAAAGCCGTGGCGCTGGTGCTCCCTAACCTGAAAGGAAAACTCAACGGGATCGCGCTGCGT
GTGCCGACTCCCAACGTCTCGGTGGTCGACTTGGTCGTGCAGGTCTCGAAGAAGACTTTCGCTGAGGAAGTCAACGCTGCCTTCAG
GGATGCGGCTGAGAAAGAGCTTAAAGGTATACTCGATGTCTGCGATGAGCCTCTTGTCTCTGTCGACTTCAGGTGCTCTGATGTGT
CGTCCACCATTGATTCTTCTCTGACCATGGTTATGGGAGATGATATGGTTAAAGTGATTGCTTGGTATGATAACGAATGGGGTTAC
TCGCAGAGAGTCGTTGATTTGGCTGACATTGTTGCCAATAACTGGAAGTGAAAAAGACTCAACTGTTTGATGTTGTTCTGCTCCAT
TTTTTATTTTACTGTTATTATTATGATTCGGAATGTATAATTGTAGTTCCTGAGTTTATATGTATTTGTGCTCTTCAAATTTTAAT
AGTAATAAACTTTATATTCGGAC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002892719 GAPA-2 [Arabidopsis lyrata subsp. lyrata]20042e-222
BAJ10475 glyceraldehyde-3-phosphate dehydrogenase [Brassica rapa subsp. chinensis]19988e-222
NP_172750 glyceraldehyde-3-phosphate dehydrogenase (NADP+) (phosphorylating) [Arabidopsis thaliana]19961e-221
BAJ34149 unnamed protein product [Thellungiella halophila]18922e-209
NP_566796 glyceraldehyde-3-phosphate dehydrogenase A [Arabidopsis thaliana]18492e-204

Swiss-Prot top hits (Blast detail)Scoree value
P25856 Glyceraldehyde-3-phosphate dehydrogenase A, chloroplastic18497e-206
P12858 Glyceraldehyde-3-phosphate dehydrogenase A, chloroplastic17743e-197
P19866 Glyceraldehyde-3-phosphate dehydrogenase A, chloroplastic17483e-194
P09315 Glyceraldehyde-3-phosphate dehydrogenase A, chloroplastic17441e-193
P09043 Glyceraldehyde-3-phosphate dehydrogenase A, chloroplastic (Fragment)17011e-188

TrEMBL top hits (Blast detail)Scoree value
Q9LPW0 At1g1290019961e-221
B9RGT1 Glyceraldehyde 3-phosphate dehydrogenase, putative18212e-201
A5BCS8 Putative uncharacterized protein18014e-199
A9PI59 Putative uncharacterized protein17989e-199
B9IA33 Predicted protein17933e-198

Arabidopsis top hits (Blast detail)Scoree value
AT1G12900.1 GAPA-2 (GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE A SUBUNIT 2); NAD or NADH binding / binding / catalytic/ glyceraldehyde-3-phosphate dehydrogenase (phosphorylating)/ glyceraldehyde-3-phosphate dehydrogenase19974e-224
AT3G26650.1 GAPA (GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE A SUBUNIT); glyceraldehyde-3-phosphate dehydrogenase/ protein binding18505e-207
AT1G12900.3 GAPA-2 (GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE A SUBUNIT 2); NAD or NADH binding / binding / catalytic/ glyceraldehyde-3-phosphate dehydrogenase (phosphorylating)/ glyceraldehyde-3-phosphate dehydrogenase17771e-198
AT1G42970.1 GAPB (GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE B SUBUNIT); glyceraldehyde-3-phosphate dehydrogenase (NADP+)/ glyceraldehyde-3-phosphate dehydrogenase14088e-156
AT1G12900.2 GAPA-2 (GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE A SUBUNIT 2); NAD or NADH binding / binding / catalytic/ glyceraldehyde-3-phosphate dehydrogenase (phosphorylating)/ glyceraldehyde-3-phosphate dehydrogenase12573e-138

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
814  42%
 
185  15%
 
198  24%
 
212  6%
 
63  9%
 
121  3%

Unigene MembersMember information