Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN10348

FASTA Sequence
Unigene ID: UN10348Length: 1110  SNP
GTGAAATGCCTCGAGATCTTCATTGTCATTCACTATTGTTACAAATGGCTAGGGTCTCTCTGTTAATTCTCCAAGCTTTATAATAA
TTAAACTATCATTAAATTAGACCTAATGATCAAGGATCTATATGCTCCTAGTAGTTTGTGAAGGAAAAACATAGGTGGCTACATAC
ACATGTAAACGATTAACGAATAATAGTATACCTCTTCTTTACAACTCTAATCAAAACTTAAAACATGGTACCCAAGCAATATAAAT
GGACAAAAGACGTAAGAAGGAAATGATGGGTACCAAAGTGATTCATCCAAAGATATATTCTAAATCCATAACAGTTAAGTTCTTCT
CCGGTCTCCATCGATAAGAAGCATCGCCCATATGATATCATATTGATCTATAAAAATCCTTCAAACTCACGGGTAAAACCAGATAC
GCCAGCTCACCTAGTTGGAAATAGGGTTTGGACCACTAGGAACTTCATGATCATCATTTGCAAACTTTCTCCTTCTAGAAGTATGG
CTGCGACGTGTGCGAGCCTTTGGATGCAGATCCATTGTTGATGAAGCTGGAACGGAAGATTCGAGAAGAACCCTCTCGAAGGGAGC
AACCGTAGATGTGGATCGATGATGAGTCATGGGGATCATAAGGTTGATGAAGAGAATGAAAGATAAGAATATGATGAAAAGAAGAA
GAGTATGAGAATGTGATGATTTAGTATTGGTTTGGTCATTTGATGTTGCCATGCAATTTAGAAAAAGAAATAACCCACCCCCCAAG
ATCCCAAGAGGGTTCAATATCCATTAACCAGAAACGAACAACTCGGGAGCTGGTCAGAGCCACGAGATAGCAGAAAGCAGAGAATA
AAATAAGAAGATGATGATAAAGAATAAGAAGAAGAATGAGATGAAACAAAAGAGAGATCTAGTAGTTAAGAAGAAGAAAGAGCCTC
TAAGAAAAGGAGAAGAAGTGAGAGATTTTCAGATTACCACACACACTTGCATTTCATTAATAAAGTAAAACCCGAAGTTGTATGCA
GAACGGTCACGAGGTATGAAATTACCAAATCACCCTTTTTGCAAGCAGCGCAGGAAAGAATGGACAAGAGTTGAATCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_566754 protein CLAVATA3/ESR-related 41 [Arabidopsis thaliana]4053e-037
AAM67331 unknown [Arabidopsis thaliana]4027e-037
XP_002883557 predicted protein [Arabidopsis lyrata subsp. lyrata]3946e-036
AAM67243 unknown [Arabidopsis thaliana]2396e-018
NP_567397 protein CLAVATA3/ESR-related 44 [Arabidopsis thaliana]2333e-017

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q84W98 At3g247704052e-037
Q8LB23 Putative uncharacterized protein4025e-037
Q8LFN1 Putative uncharacterized protein2394e-018
Q941C5 At4g13194/At4g131942332e-017
C6TJW1 Putative uncharacterized protein1623e-009

Arabidopsis top hits (Blast detail)Scoree value
AT3G24770.1 CLE41 (CLAVATA3/ESR-RELATED 41); protein binding / receptor binding4069e-040
AT4G13195.1 CLE44 (CLAVATA3/ESR-RELATED 44)2348e-020

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
122  15%
 
112  15%
 
84  31%
 
92  15%
 
72  15%
 
61  8%

Unigene MembersMember information