Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN10396

FASTA Sequence
Unigene ID: UN10396Length: 1235  SNP
GGTGCTTTAATGTACATATTAAAAAAACAAAAACTGTGAAAACTTAGACATGGACATAATTTCCTCACTTTTTCTAGTGAAAATTA
TATTTATTTTGAACACTCAAGGTTCTTAATTCGTCAAAGAGAGTGCAAAACCAAAAATGCATGGTCTCAATTCAACAACAACAAAG
CAAACTAAGTGTATGACATCAAGCATTCGAAGTTATGCAGTAGTACTATGTTGTAGAACGTCAAATAACTGAAAAACATGATCAAG
AAAGACAATAAAATAAAAAAAAATACACATTTTTCCGAGCAACGACACTTGCTGTCTTCGGATGCATCAAAGGTCGTTTCTCTTCA
CACAGAGGATTCAGTTCTCTTCTTTCGGCTCATCACCTTTGGATTTCTCTTCTCCTTCCTCCGGGAGGTCAGAAGTCCACAGGGTG
AGATTGTCTCTAAGAAGCTGCATGATAAGAGTGCTGTCCTTGTATGACTCCTCGTTGAGGCTGTCAAGTTCAGCGATTGCATCGTC
AAATGCTTGCTTAGCCAATTGGCATGCGCTTTCAGGAGAGTTTAAGATCTCGTAGTAGAAAACAGAAAAGTTCAAAGCCAAGCCAA
GTCTAACTGGATGTGTGGGTGCCAAACCAGTGTCTGCAGCAGCAACAGCAGCCTTGTATGCTTCAAGAGACTGATCTGCAGCTTCC
TTGCGTTCAGTACCAGAACTGAACTCTGCCAGATAGCGATAGTAATCTCCTTTCATTTTGTAGAAAAAGACGGTGGACTCAACAGC
GGTAGAGGAAGGAATGAGGTGCTTGTCAATGACAGACAAGATGTCATTACAAACTTTGGCAAGCTCGTCTTCAACCCTCTTTCGGT
AAGTCTGAATCCTCTTGACATTCTCCTCGTTCCCCTTGGACTCTTCCTTCTGCTCGATGGAGGATAGTATCCTCCACGAAGCTCTC
CTTGCGCCAATGACGTTCTTGTAACCCACAGATACGAGGTTTCTCTCCTCCACGGTGAGCTCCACATCCATCTCTGCTACTTTCTT
CATTGCCTCAACCATCTCATCGTATCGTTCGGTTTGCTCGGAGAGCTTCGCCGAGTAAACCTGCTTTTCCCTCTCAGTCTCCATGC
CTTCTTTCTTCTCTCTGTCTGAAACAAACAATGGATGCTCTCTCTATTTTGATCTCGAGATTAGTGGTAACCCTAGAATGGCTCTG
ATGCTAAATATACCGGCCCCGTTGGATCTCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
ACN73532 1433-1 [Brassica napus]12442e-134
ADO95305 14-3-3-like protein GF14 Epsilon [Eutrema salsugineum]12173e-131
XP_002893217 hypothetical protein ARALYDRAFT_313117 [Arabidopsis lyrata subsp. lyrata]12031e-129
NP_564167 14-3-3-like protein GF14 epsilon [Arabidopsis thaliana]11851e-127
NP_849698 14-3-3-like protein GF14 epsilon [Arabidopsis thaliana]11797e-127

Swiss-Prot top hits (Blast detail)Scoree value
P48347 14-3-3-like protein GF14 epsilon11856e-129
P93212 14-3-3 protein 710592e-114
Q9S9Z8 14-3-3-like protein GF14 omicron9912e-106
Q96453 14-3-3-like protein D9893e-106
P93214 14-3-3 protein 99875e-106

TrEMBL top hits (Blast detail)Scoree value
C0KJK4 1433-112441e-134
B9DFR1 AT1G22300 protein11794e-127
Q3ED73 Putative uncharacterized protein At1g22300.311445e-123
B9RJK9 14-3-3 protein, putative10952e-117
A1XJ43 14-3-3-like protein10801e-115

Arabidopsis top hits (Blast detail)Scoree value
AT1G22300.1 GRF10 (GENERAL REGULATORY FACTOR 10); ATP binding / protein binding / protein phosphorylated amino acid binding11864e-130
AT1G22300.2 GRF10 (GENERAL REGULATORY FACTOR 10); ATP binding / protein binding / protein phosphorylated amino acid binding11792e-129
AT1G22300.3 GRF10 (GENERAL REGULATORY FACTOR 10); ATP binding / protein binding / protein phosphorylated amino acid binding11443e-125
AT1G34760.2 GRF11 (GENERAL REGULATORY FACTOR 11); ATPase binding / amino acid binding / protein binding / protein phosphorylated amino acid binding10172e-110
AT1G34760.1 GRF11 (GENERAL REGULATORY FACTOR 11); ATPase binding / amino acid binding / protein binding / protein phosphorylated amino acid binding10117e-110

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
914  33%
 
613  30%
 
119  21%
 
84  9%
 
201  2%
 
122  5%

Unigene MembersMember information