Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN10397

FASTA Sequence
Unigene ID: UN10397Length: 757  SNP
GATCAAAAGCTCACATTAAGAGAGAGAAGTAGACAACAAGTCTTTCACATTAAAAAAAAAAAAAAAAAAAAAAACCCACCGGAGAA
AAAAAAGAAGAAGAAGATGTCGTGGCAATCGTACGTTGATGACCACCTCATGTGCGACGTCGAAGGCAGCCAGCTCACCGCCGCCG
CTATTCTCGGCCAAGACGGCAGTGTCTGGGCTCAGAGCGCCAATTTCCCTCAGTTGAAGAGTGAAGAAATCAAAGGAATCACAAAG
GACTTCGAGGAGCCTGGGCATCTTGCACCAACCGGACTCTTTCTGGGTGGAGCCAAGTACATGGTTATTCAAGGTGAGCCAGGAGC
TGTGATCCGAGGCAAGAAGGGACCTGGAGGAGTTACTATCAAGAAGACGAATCAAGCATTGGTCATTGGCATCTACGAGGAGCCCA
TGACTGGTGGTCAATGCAACTTGGTTGTGGAGAGGCTCGGGGATTACCTCATCGAGTCTGATCTCTAAATTTTTCAGTTTCAAAAG
TCTCTTCTTTTCATTGTGATTGAATCGTAATGCTATCAAAACGCAAATCAATTTGAAGCTTTTGAACCAATATCTTGTTGTTGGTC
TTTGTTACTACCGGGTTTGTGTGTCTTATGTAATGGCATTTTGATCATCTTTTTATCCCTCCATATGCATTGTGTTTTTTTTTTTG
GATTTTTATATCTCCATAGTTTTATTTTCCTTGAATTGATCTGCGGTTGGTTTACGTTTTGTGGTTTTG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_179566 profilin 1 [Arabidopsis thaliana]6157e-062
XP_002883973 PFN1/PRF1 [Arabidopsis lyrata subsp. lyrata]6032e-060
3NUL Chain A, Profilin I From Arabidopsis Thaliana5923e-059
XP_002869438 PFN2/PRF2/PRO2 [Arabidopsis lyrata subsp. lyrata]5923e-059
BAJ34266 unnamed protein product [Thellungiella halophila]5923e-059

Swiss-Prot top hits (Blast detail)Scoree value
Q42449 Profilin-16153e-063
Q42418 Profilin-25894e-060
Q9STB6 Profilin-25868e-060
P0C0Y3 Profilin5751e-058
Q93YI9 Profilin5706e-058

TrEMBL top hits (Blast detail)Scoree value
C0Z3G0 Profilin5895e-059
Q8LCJ1 Profilin5833e-058
Q38HU3 Profilin5781e-057
Q8H123 Profilin5781e-057
Q8H2C7 Profilin (Fragment)5781e-057

Arabidopsis top hits (Blast detail)Scoree value
AT2G19760.1 PRF1 (PROFILIN 1); actin binding6162e-064
AT4G29350.1 PFN2 (PROFILIN 2); actin binding / protein binding5902e-061
AT5G56600.1 PRF3 (PROFILIN 3); actin binding5795e-060
AT4G29340.1 PRF4 (PROFILIN 4); actin binding5472e-056
AT2G19770.1 PRF5 (PROFILIN5); actin binding / actin monomer binding5429e-056

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
66  26%
 
94  17%
 
123  13%
 
102  9%
 
115  22%
 
201  4%
 
181  4%
 
141  4%

Unigene MembersMember information