Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN10398

FASTA Sequence
Unigene ID: UN10398Length: 430  SNP
GGGGTCCACCTTTGAGAAAAAATGGCAAGCAATATGGAAGTTTTCTGCGAGATCTTGATCGCAGTCCTTCTTCCTCCTCTTGGAGT
CTGCCTCAAGCGTGGCTGCTGCACTGTAGAGTTCTTGATATGCTTGGTGTTGACTATCTTGGGCTACATCCCTGGGATAATCTATG
CTATATACGTGATCGTATTTCAGAACCGTGAAGGGGAAACTCAGGACTACAGTGCTCCACTCAACTCAGCTTGAGATTATCTGTTG
GTCCATTCAATGTCTTTGAGACTGTTTTAATTATGTAACCACTAAATAAGTTGCTATGCAATCTCATCAGTTTCCTTATCATGTAT
ATTCAGCTATTCAAGTCATGCCAATTTCATAGAATGACTTTTGACTATTGCACTGCATCACATGAATACTGACTCTTTTGTATTCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
AAT11798 salt and low temperature response protein [Brassica rapa subsp. pekinensis]3812e-035
AAV35467 cold and salt response protein [Brassica napus]3732e-034
NP_194794 putative low temperature and salt responsive protein [Arabidopsis thaliana]3392e-030
XP_002869366 hypothetical protein ARALYDRAFT_913410 [Arabidopsis lyrata subsp. lyrata]3265e-029
XP_002869365 hypothetical protein ARALYDRAFT_913409 [Arabidopsis lyrata subsp. lyrata]3078e-027

Swiss-Prot top hits (Blast detail)Scoree value
Q9M095 UPF0057 membrane protein At4g306503391e-031
Q9SUI0 UPF0057 membrane protein At4g306602961e-026
O82232 UPF0057 membrane protein At2g240402539e-022
Q9LRI7 Hydrophobic protein OSR82044e-016
Q9ZNQ7 Hydrophobic protein RCI2A1776e-013

TrEMBL top hits (Blast detail)Scoree value
Q6GYJ6 Salt and low temperature response protein3812e-035
Q5URQ9 Cold and salt response protein3731e-034
C0SVK6 Putative uncharacterized protein At4g30650 (Fragment)3391e-030
B9DGR8 AT4G30660 protein2914e-025
B9STT9 Hydrophobic protein OSR8, putative2682e-022

Arabidopsis top hits (Blast detail)Scoree value
AT4G30650.1 hydrophobic protein, putative / low temperature and salt responsive protein, putative3434e-033
AT4G30660.1 hydrophobic protein, putative / low temperature and salt responsive protein, putative2978e-028
AT4G30660.2 hydrophobic protein, putative / low temperature and salt responsive protein, putative2978e-028
AT4G28088.1 hydrophobic protein, putative / low temperature and salt responsive protein, putative2574e-023
AT2G24040.1 hydrophobic protein, putative / low temperature and salt responsive protein, putative2531e-022

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
815  27%
 
1222  40%
 
94  7%
 
113  5%
 
64  7%
 
105  9%
 
72  4%

Unigene MembersMember information